10 лада: Купить LADA (ВАЗ) 2110 с пробегом: продажа автомобилей Лада 2110 б/у

Содержание

Официальный сайт LADA

25.05.2021

Лидеры российского рынка автострахования совместно с АВТОВАЗом запустили массовые программы доступно

«Ингосстрах», «АльфаСтрахование», «Согласие», «Росгосстрах» и «ВСК» запустили специальные программы «умного» страхования (основанное на данных о фактическом использовании или UBI) для автомобилей LADA, подключенных к телематической платформе LADA Connect. Проект направлен на развитие рынка добровольного страхования автомобилей массового сегмента. Первым участником программы станет самый продаваемый в России автомобиль – LADA Granta. Новые массовые программы UBI сделают страхование существенно доступнее. При покупке автомобилей, оснащенных LADA Connect, единоразовая дополнительная скидка на полис КАСКО составит 10%. Кроме того, владельцы «подключенных» автомобилей смогут получать дополнительную скидку при продлении договора страхования до 30% в зависимости от качества вождения (скоринг вождения выполняется автоматически на основе данных телематики LADA Connect).

Оливье Морне, вице-президент по продажам и маркетингу марки LADA: «LADA Connect – это новый уровень сервиса и комфорта для наших клиентов. Интеграция технологий Connected Car на этапе производства выполняет еще и важную социальную функцию, повышая доступность добровольного страхования. «Умное» страхование позволяет заметно снизить стоимость полиса. До этого момента его развитие, особенно в массовом сегменте, осложнялось тем, что затраты на установку оборудования могли себе позволить не все автовладельцы и страховые компании. Мы решили данную проблему на системном уровне». Автомобили Granta, оснащенные LADA Connect, уже доступны к заказу в Москве и Московской области, Санкт-Петербурге, Самарской области, Татарстане и в Пермском крае, а в ближайшие месяцы – по всей официальной дилерской сети.Работа LADA Connect основана на техническом решении компании «Лаборатория умного вождения», часть которого – телематическая платформа со специальной системой страхового скоринга обрабатывает данные о вождении и с согласия автомобилиста передает их страховым компаниям. На основе этих данных формируются индивидуальные предложения. Директор по развитию ООО «Лаборатория Умного Вождения» Тимур Кузеев: «Запуск LADA Granta, оснащенных LADA Connect, – эпохальное событие для страхового рынка России. Мы совместно с АВТОВАЗом и лидерами нашего страхового рынка проделали серьезную работу и создали уникальный для массового сегмента продукт, учитывающий лучшие международные практики и опыт, который в перспективе нескольких лет может вывести нашу страну в мировые лидеры по количеству программ UBI. Это значительно повысит инвестиционную привлекательность нашего рынка для глобального автобизнеса». Индивидуализация страховых тарифов выполняет ряд важных общественно значимых функций. По мнению участников рынка, распространение UBI-программ приведет к заметному повышению безопасности движения, сделает страховые продукты доступными для начинающих водителей, прививая им ответственный подход к использованию автомобиля, снизит уровень страхового мошенничества и обеспечит доступ к КАСКО в массовом сегменте, изменяя отношение к страхованию в обществе.
Член правления ПАО «Росгосстрах» Елена Белоусенко: «Запуск UBI-программ для LADA Granta, оборудованных LADA Connect, приведет к повышению устойчивости и стимулирует развитие российского рынка автострахования. Индивидуализация скоринга по характеру вождения, позволяет персонализировать оценку. На практике это означает, что для клиента отпадет необходимость платить за чужие риски, и мы сможем предлагать более доступные тарифы, которые сделают КАСКО привлекательным продуктом в массовом сегменте. Мы рады быть участником такого масштабного проекта и считаем, что именно «умное» страхование – это ключевой фактор формирования массового устойчивого страхового рынка».При пролонгации скидка за аккуратное вождение будет суммироваться со стандартным страховым коэффициентом бонус-малус, что снизит стоимость полиса для аккуратных водителей до 50%. Такое снижение цен, как ожидают страховщики, позволит заметно повысить проникновение добровольного автострахования в нашей стране.Директор по маркетингу АО «РН-Банк» Алла Кибизова: «РН Банк, как оператор программ страхования для брендов Альянса, в который входит бренд LADA, видит своей миссией предоставление максимального уровня сервиса клиентам Альянса.
Запуск «умного» страхования, с одной стороны, позволит клиентам LADA получать более выгодные условия по страхованию от крупнейших страховщиков, а c другой – выступит драйвером для дальнейшего развития технологий «умного» страхования на российском рынке. Мы видим запуск такого масштабного проекта примером успешной коллаборации крупнейших игроков автомобильного и страхового рынков с целью создать уникальный продукт с высокой клиентской ценностью».Платформа LADA Connect работает по принципу «черного ящика», собирая данные, которые помогают восстанавливать обстоятельства ДТП. Это упрощает и существенно ускоряет процедуру страхового урегулирования, позволяя для удобства автомобилистов частично автоматизировать бюрократические процедуры и переносить их в онлайн. Кроме того, за счет интеграции этой технологии у автовладельцев появится возможность урегулировать убытки без предоставления справок из компетентных органов по событиям, зафиксированным платформой LADA Connect. Заместитель генерального директора по розничному бизнесу СПАО «Ингосстрах» Алексей Власов: «Мы активно работаем с «умными» программами с 2015 года, но их доля в структуре нашего портфеля пока невелика.
Причина в достаточно высоких операционных расходах на само оборудование, его установку и подписку на информационный обмен. При этом выгоды таких программ очевидны для нашей компании как в части сбора скоринговых данных и возможности контроля убытков, так и в части развития продуктового предложения «Ингосстраха». Мы крайне позитивно оцениваем внедрение Connected Car с телематическим функционалом от крупнейшего автопроизводителя в стране». Одним из преимуществ LADA Connect является пересекающаяся интеграция данных, которая создает единую экосистему коммуникации между партнерами и участниками проекта. Например, автовладелец сразу после оформления договора страхования сможет видеть условия страховой программы в мобильном приложении LADA Connect. Там же он сможет отслеживать свой текущий скоринговый балл для скидки на пролонгацию. Руководитель практики Affinity ООО «Страховой Брокер Виллис СНГ» Аррожейро Элдер Жорж Мартинью и Генеральный директор ООО «АСТ» (генеральный партнер Willis Towers Watson по розничному автострахованию в России) Каро Карапетян: «Оформление договоров страхования в дилерских центрах LADA реализуется через централизованную IT-систему выпуска полисов, разработанную партнером RCI Group (АО «РН-Банк» - банк Альянса Renault-Nissan-Mitsubishi) международным брокером Willis Towers Watson (NASDAQ: WLTW), внедренную и обслуживаемую совместно с ООО «АСТ».
Это позволяет оптимизировать процесс работы со страховой документацией в одной системе, а также вести единую отчетность со страховщиками. Процесс полностью автоматизирован для дилеров и автопроизводителя, что значительно упрощает процесс работы и управления. Внедрение «умных» программ позволит реализовать дополнительную сервисную поддержку для Клиентов и значительно упростит сопровождение при наступлении страховых случаев». Мировая практика развития «умного» страхования предполагает два пути. Первый – интеграция телематических решений страховыми компаниями, которые продают или дают в аренду «черные ящики» автовладельцам на время действия полиса. Второй – формирование страхового продукта на основе данных, собираемых системой, интегрированной на этапе производства. Второй подход привел к бурному росту «умного» страхования в ЕС, США и Китае в последние годы. В России в силу низкого проникновения добровольного автострахования и исторических особенностей рынка первый путь оказался неэффективен.
На этом фоне интеграция телематических систем такими крупными производителями, как АВТОВАЗ, будет стимулировать рынок и повлечет за собой существенный рост проникновения не только «умного» КАСКО, но и добровольного автострахования в целом.Заместитель генерального директора по развитию бизнеса ВСК Ольга Сорокина: «Мы рады старту нового проекта с АВТОВАЗом. Недавно мы обновили программу «Умное КАСКО» для удобства потребителей, оптимизировав внутренние процессы компании с интеграцией оператора телематики. Запуск серийного производства автомобилей LADA с телематической платформой Connected Car позволит реализовать специальные страховые программы и предложить новые возможности для наших клиентов. Благодаря проекту аккуратным водителям будут доступны более персонифицированные условия страхования по КАСКО, дополнительная скидка на страховку автомобиля».По данным ЦБ в 2020 году проникновение КАСКО к ОСАГО в России составило 9,6%. Это очень скромный по мировым меркам результат. Для сравнения, в ЕС этот показатель достигает 78%.
Распространение «умного» страхования в массовом сегменте рынка позволит увеличить его, не повышая убытки страховых компаний, что в перспективе может привести к еще большей доступности добровольного страхования.Директор департамента андеррайтинга автострахования АО «АльфаСтрахование» Илья Григорьев: «Наша компания стратегически нацелена на развитие современных программ и технологий, позволяющих улучшать качество клиентского сервиса и портфеля. Благодаря запуску LADA Granta, оснащенных LADA Connect, мы видим большие возможности синергии использования сервисов Connected Car и потенциал для развития современных страховых программ». Лежащая в основе принципа работы «умного» страхования индивидуализация страхового предложения происходит на основе данных о фактическом вождении – сколько и где автомобиль ездит, как часто водитель нарушает правила, превышает скорость или совершает опасные маневры. Сбор этих данных происходит тремя путями: через так называемые «черные ящики» – стационарно установленные в авто подключенные к сети интернет-устройства с акселерометром и GPS/ГЛОНАСС чипом, через мобильные приложения или простые GPS-трекеры.
АВТОВАЗ пошел по самому технологичному и перспективному пути, выбрав для своих автомобилей продвинутую «подключенную» систему, которые в мировой практике пока редко применяется при производстве автомобилей массового сегмента. Андрей Ковалев, Директор по розничному андеррайтингу и партнерским продажам страховой компании «Согласие»: «ООО «Согласие» является партнером LADA Страхование с момента запуска программ от автопроизводителя в партнерстве с АО «РН-Банк». Мы следили за ходом реализации проекта и ждали запуск LADA Granta, оснащенных LADA Connect. Функционал автомобиля и телематической платформы позволяет нам вести контроль статистики и убытков в режиме онлайн. В наших планах наращивать продажи специальных программ для «подключенных автомобилей» — это позволит вывести управление продуктами на новый современный уровень и предложить для наших клиентов новые сервисные возможности». LADA Connect позволяет владельцу удаленно управлять функциями автомобиля при помощи смартфона, а также получать статистическую информацию об использовании автомобиля, которая помогает контролировать эксплуатационные расходы и вести удаленную коммуникацию с дилерскими центрами LADA и Автопроизводителем.
Генеральный директор «Лаборатории Умного Вождения» Михаил Анохин: «Создание современной цифровой экосистемы вокруг автомобилей LADA открывает новые возможности для автовладельцев и связанных с автомобилями бизнесов. Запуск программ доступного UBI-страхования стало одним из первых подобных решений. Надеюсь, что наши совместные разработки послужат надежным связующим звеном между страховыми компаниями и автомобилистами и это позволит покупателям LADA получить самый доступный и удобный страховой продукт на рынке».***Контакты PR-Служб: АО «АВТОВАЗ» - (8482) 75-77-15, +7 (499) 263-08-50, e-mail: [email protected] ПАО «СК «РОСГОССТРАХ» - Бирюков Андрей Аскольдович (Andrey Biryukov), Руководитель блока PR ПАО «СК «РОСГОССТРАХ», Моб.: +7-910-404-94-56, e-mail: [email protected]СПАО «Ингосстрах» - Людмила Мегаворян, Пресс-секретарь, Моб.: +7 915 402 02 10, [email protected] САО «ВСК» - Ларин Павел, Руководитель направления по связям с общественностью Департамент маркетинговых коммуникаций и PR, Блок развития бизнеса, Тел.
: +7 (495) 7274444, доб. 2962, Моб.: +7 926 503-17-00, [email protected] ООО «СК «Согласие» - Елена Григорьева, Моб.: +7 903 599 35 59, Олеся Карпова, Моб.: +7 926 911 00 38, e-mail: [email protected]АО «АльфаСтрахование» - Карцева Мария, Руководитель PR-Службы АО «АльфаСтрахование», Моб.: +7 962 923-74-49, e-mail: [email protected] ООО «АСТ» - Наталья Дегтярева, Директор по маркетингу и развитию, Моб.: +7-903- 100-45-72, e-mail: [email protected] ООО «Лаборатория Умного Вождения» - Александр Корольков, +7-915-497-65-75, e-mail: [email protected] ***Группа ''АВТОВАЗ'' является частью бизнес-подразделения Dacia-LADA в структуре Groupe Renault. Компания производит автомобили по полному производственному циклу и комплектующие для 2-х брендов: LADA и Renault. Производственные мощности АВТОВАЗа расположены в Тольятти – АО ''АВТОВАЗ”, ОАО “LADA Запад Тольятти”, а также в Ижевске – ООО ''LADA Ижевск''. Продукция марки LADA представлена в сегментах В, B+, SUV и LCV и состоит из 5 семейств моделей: Vesta, XRAY, Largus, Granta и Niva. Бренд лидирует на российском автомобильном рынке с долей более 20% и представлен в более чем 20 странах. LADA имеет самую большую официальную дилерскую сеть в России – 300 дилерских центров.ПАО СК «Росгосстрах» — флагман отечественного рынка страхования. На территории Российской Федерации действуют около 1 500 офисов и представительств компании, порядка 300 центров и пунктов урегулирования убытков. В компании работает около 50 тысяч сотрудников и страховых агентов. «Росгосстрах» входит в Группу «Открытие» — один из крупнейших финансовых холдингов нашей страны, и является стратегическим провайдером страховых продуктов и услуг в компаниях группы «Открытие».СПАО «Ингосстрах» - работает на международном и внутреннем рынках с 1947 года, занимает лидирующие позиции среди российских страховых компаний.«Ингосстрах» имеет право осуществлять все виды имущественного страхования, добровольное медицинское страхование и страхование от несчастных случаев и болезней, установленные ст.32.9 Закона РФ «Об организации страхового дела в Российской Федерации», а также перестраховочную деятельность. Компания присутствует в 251 населенном пункте РФ. Представительства и дочерние компании страховщика работают в странах дальнего и ближнего зарубежья.Страховой Дом ВСК (САО «ВСК») работает с 1992 года и является универсальной страховой компанией, предоставляющей услуги физическим и юридическим лицам на всей территории России. Компания стабильно входит в ТОП-10 страховщиков страны по сборам в основных сегментах страхового рынка – автостраховании, страховании от несчастных случаев и болезней (НС) и добровольном медицинском страховании (ДМС). На сегодняшний день более 30 млн человек и 500 тысяч организаций воспользовались продуктами и услугами ВСК. Региональная сеть компании насчитывает свыше 500 офисов во всех субъектах России, что дает возможность эффективно сопровождать договоры страхования по всей стране.ООО «СК «Согласие» входит в единую страховую группу с ООО «Согласие-Вита» и успешно ведет свою деятельность на страховом рынке уже более 27 лет. Внутренняя политика Компании позволяет нам уверенно удерживать высокие позиции на страховом рынке и ежегодно увеличивать число страхователей. Группа «АльфаСтрахование» – крупнейшая частная российская страховая группа с универсальным портфелем страховых услуг, который включает как комплексные программы защиты интересов бизнеса, так и широкий спектр страховых продуктов для частных лиц. Услугами «АльфаСтрахование» пользуются более 31 млн человек и свыше 106 тыс. предприятий. Региональная сеть насчитывает 270 филиалов и отделений по всей стране. Надежность и финансовую устойчивость компании подтверждают рейтинги ведущих международных и российских рейтинговых агентств: «ВВ+» по шкале Fitch Ratings, «ВВB-» по шкале S&P и «ruАAA» по шкале «Эксперт РА» и «ААА ru» по шкале «Национального рейтингового агентства».«РН-БАНК» – «Банк Альянса Renault-Nissan-Mitsubishi». Почти вековая история Банковской Группы Рено берет свое начало в 1924 году во Франции. Сейчас Группа представлена в 36 странах мира, а на российском рынке оказывает поддержку клиентам, выбирающим продукцию брендов Альянса, с 2006 года. Приоритетными направлениями деятельности Банка являются: кредитование физических лиц на приобретение автомобилей брендов Альянса, финансирование дилеров брендов Альянса, а также оказание клиентам сопутствующих финансовых услуг. По состоянию на конец 1 квартала 2021 года Банк занимает 52 место по размеру активов среди российских банков по версии Интерфакс, поднявшись на 6 позиций за 15 месяцев.Willis Towers Watson — ведущая международная консалтинговая и брокерская компания, разрабатывающая современные бизнес-решения, которые помогают нашим клиентам по всему миру преобразовывать риски в возможности развития и роста. Наша компания была основана в 1828 г., и в настоящее время насчитывает 45 000 сотрудников, предоставляющих услуги для более чем 140 стран и рынков. «Страховые брокеры «АСТ» - являются одним из ведущих страховых брокеров, оказывающих полный спектр страховых брокерских услуг и услуг в области риск консалтинга с 2007 года. ООО «Страховые брокеры «АСТ» оказывают страховые брокерские услуги по всем видам страхования, а также не противоречащие законодательству Российской Федерации сопутствующие консультационные услуги в области управления рисками.«Лаборатория умного вождения» – российский разработчик универсальной автомобильной телематической платформы и системы LADA Connect. Созданные в «Лаборатории умного вождения» аппаратно-программные решения превращают автомобиль в подключённое к сети Интернет устройство. Специалисты «Лаборатории умного вождения» оказывают адаптированный под каждого клиента набор услуг – от круглосуточного мониторинга состояния автомобиля и защиты от угона до анализа эксплуатационных параметров, контроля расходов и оценки безопасности вождения. Страховым компаниям решения «Лаборатории умного вождения» помогают провести селекцию страхового портфеля и сформировать индивидуальные страховые тарифы для клиентов. Автопроизводителям и автопаркам – внедрить инновационные подходы в бизнесе.

АВТОВАЗ: LADA GRANTA - ИМЯ LADA 2190

АВТОВАЗ подвел итоги конкурса ''LADA: народной машине - народное название''. Жюри во главе с президентом АВТОВАЗа Игорем КОМАРОВЫМ выбрало имя для LADA 2190 - LADA GRANTA: победил Павел ЗАХАРОВ из Красноярска.

Павел ЗАХАРОВ первым прислал на www.lada.ru название GRANTA для LADA 2190 - новой машины АВТОВАЗа, которая сойдет с конвейера в Тольятти уже в 2011 году.

На Московском международном автосалоне в августе автор народного названия получит ключи от призового автомобиля LADA Kalina. Сюрприз от АВТОВАЗа: Павел ЗАХАРОВ будет ездить не просто на LADA Kalina. Приз конкурса - автомобиль, который сошел с конвейера автозавода 9 августа - 26 000 000-ная машина тольяттинского гиганта. Это LADA Kalina в комплектации ''люкс''.

Еще 9 человек - жители Москвы, Ростова-на-Дону, Бугульмы (Татарстан), подмосковного Жуковоского, Энгельса (Саратовская область), а также по двое тольяттинцев и самарцев - стали призерами конкурса. Предложенные ими варианты пополнили резерв названий для будущих моделей АВТОВАЗа. Компания пока не планирует обнародовать предложенные имена.

Согласно условиям, призами награждается 10 человек: обладатели 2 и 3 места приедут в Тольятти на АВТОВАЗ - увидят конвейер завода, научно-технический центр и Технический музей. Участники, занявшие с 4 по 10 место, получат по комплекту сувенирной продукции АВТОВАЗа. Все участники конкурса, занявшие первые десять мест, также получат благодарственные грамоты за подписью Президента компании и приглашения на посещение Московского автосалона.

Конкурс на лучшее имя для новой модели LADA 2190 проходил с 30 июня по 8 июля 2010 года - все желающие (кому уже исполнилось 18 лет) могли на сайте www.lada.ru предложить несколько вариантов названия для ''народного автомобиля'', который пойдет в серию в конце 2011 года.

Жители более 900 городов, 700 сел и деревень прислали на сайт АВТОВАЗа свои имена для новой LADA. Конкурс показал, что автомобили LADA любят во многих странах - электронные письма приходили из России, Болгарии, Эстонии, Израиля, Румынии, Казахстана, Белоруссии, Украины, Латвии, Литвы - огромное спасибо всем!

Всего в конкурсе принял участие 48 771 человек. Было предложено 169 082 названия, из них 36 429 - оригинальные (без повторов).

Лидер по количеству заявок на конкурс - Самарская область: более 8 тысяч человек предложили свои названия, из них свыше 6 тысяч - жители Тольятти. Почти столько же участников (более 7 тысяч) из Москвы и Московской области; около 3 тысяч - из Санкт-Петербурга и Ленинградской области.

Группа "АВТОВАЗ" является частью бизнес-подразделения Dacia-LADA в структуре Groupe Renault. Компания производит автомобили по полному производственному циклу и комплектующие для 2-х брендов: LADA и Renault. Производственные мощности АВТОВАЗа расположены в Тольятти – АО "АВТОВАЗ”, ОАО “LADA Запад Тольятти”, а также в Ижевске – ООО "LADA Ижевск".

Продукция марки LADA представлена в сегментах В, B+, SUV и LCV и состоит из 5 семейств моделей: Vesta, XRAY, Largus, Granta и Niva. Бренд лидирует на российском автомобильном рынке с долей более 20% и представлен в более чем 20 странах. LADA имеет самую большую официальную дилерскую сеть в России – 300 дилерских центров.

ГК АГАТ (ООО Автопрофиль) – Официальный дилер LADA в г. Нижний Новгород

Топ-5 причин популярности автомобиля LADA

Автомобиль LADA входит в пятерку самых покупаемых машин сегодня. Это можно объяснить следующими причинами:

  • Отличные технические характеристики. Каждый автомобиль разработан с учетом условий эксплуатации в нашем микроклимате.
  • Доступное обслуживание и ремонт. При необходимости в любом магазине Вы можете найти необходимую Вам деталь.
  • Минимальная цена — LADA не имеет конкурентов в своей ценовой нише.
  • Высокий уровень оснащения и безопасности.
  • При необходимости возможность установки дополнительного оборудования.

Автосалон «АГАТ» — выгодное решение!

Вы спросите, почему у нас покупать автомобиль выгодно? Мы с радостью ответим на Ваш вопрос! Компания АГАТ является официальным дилером LADA, что дает ряд преимуществ:

  • В автосалоне LADA компании АГАТ всегда в наличии полный модельный ряд автомобилей LADA. Машины всех цветов, комплектаций специально для Вас!
  • Кроме того, если автомобиля нет в наличии на данный момент, то есть возможность оформить заказ.
  • У Вас есть уникальная возможность купить LADA по самой выгодной цене в Нижнем Новгороде (от производителя).

Условия покупки

Мы заботимся о каждом нашем клиенте, поэтому предлагаем уникальные условия покупки для каждого.  В автосалоне LADA компании АГАТ Вы можете купить автомобиль LADA в Нижнем Новгороде:

  • в кредит
  • в лизинг

Сотрудничество с ведущими кредитными организациями помогает нам обеспечить низкие процентные ставки и разработать специальные программы для своих клиентов.

Корпоративным клиентам

Мы предоставляем уникальные возможности для корпоративных клиентов: индивидуальный подход, выгодные условия покупки — критерии, которые позволяют нам заключать долгосрочные партнерские отношения и приобретать с каждым годом всё больше покупателей.

О сервисном обслуживании

Автосалон LADA в Нижнем Новгороде компании АГАТ предлагает также сервисное обслуживание автомобилей LADA. Наши специалисты с профильным образованием, что дает гарантию качественного обслуживания и ремонта. Интерактивная приемка и предварительная запись дают возможность избежать длинных очередей и долгих часов ожидания. Подробнее о сервисном обслуживании Вы можете прочитать здесь.

Автосалон LADA в Волгограде компании АГАТ — выбирайте свою машину!

10 необычных моделей Lada, которые не пошли в серию :: Autonews

Недавно в сети рассекретили внешность обновленной Lada Niva. Шпионские изображения прототипа нового внедорожника, который стал очень похож на Toyota RAV4, появились в социальных сетях. Сам АвтоВАЗ отказался как-либо комментировать утекшие в фотографии, однако источник Autonews.ru, знакомый с ходом работы над проектом, подтвердил подлинность запечатленной машины. При это он отметил, что это пока еще не окончательно утвержденный вариант внешности, который получит автомобиль. И пока в сети не утихают споры о дизайне новой «Нивы», мы решили вспомнить самые знаковые концепты и прототипы АвтоВАЗа, которые, увы, так и не стали серийными.

Проект Х

Экспериментальные модели ВАЗа всегда отличались невероятными техническими решениями. Чего только стоила роторная «копейка» или полностью электрическая версия универсала 2102. Однако с точки зрения дизайна автомобили отечественного автогиганат мало чем удивляли. Так было до тех пор, пока в середине 1980-х не был создан концепт, загадочно названный буквой «Х».

Малоизвестный проект представлял собой размышления на тему автомобиля 2000 года. В качестве такого вазовцы видели семейный семиместный однообъемник сравнительно компактного размера с аэродинамичным кузовом и оригинальным ветровым стеклом. Причем помимо пятидверного автомобиля к выпуску планировался и укороченный трехдверный вариант. А строить эти машины планировали на базе серийного ВАЗ-2108 с его агрегатами. Был создан лишь один макет в натуральную величину и две модели в масштабе 1:5. Проект был отложен, а к началу 1990-х заводу уже было не до экспериментов. 

Рапан

К концу 1990-х годов, когда положение завода все еще было сложным, но уже не столь катастрофичным, на АвтоВАЗе вновь вернулись к постройке экспериментальных машин и прототипов. В тот период мода на биодизайн с его округлыми формами уже начала сходить на нет, но вазовский концепт «Рапан» все равно произвел фурор на Парижском автосалоне 1998 года.

Сложносочиненные линии кузова, большая площадь остекления и сдвижные двери по-настоящему удивляли. Внутри у автомобиля был совершенно ровный пол, а кресла поворачивались вокруг оси. Удивлял и руль с фиксированной центральной частью и встроенными приборами. Но главное, что «Рапан» был электрокаром! Агрегаты и батарея были заимствованы у экспериментальной электрической модификации «Оки». Но заводчанам такая проработка не помогла. На тот момент предприятие так и не нашло инвесторов на осуществление смелого проекта. А прототип, созданный в единственном экземпляре, так и остался в музее завода.

Родстер

В период, когда на ВАЗе создавался этот стильный концепт, свет увидели Audi TT первого поколения, Porsche Boxter и еще несколько знаковых спортивных моделей эпохи миллениума. Поэтому неудивительно, что тольяттинский дизайнер Николай Нужный, стажировавшийся в итальянском ателье Sbarro, для нового прототипа Lada выбрал именно кузов родстер. Машина удивляла и тем, что была сделана в эпоху серьезных финансовых проблем автогиганта и будто создавалась наперекор всем невзгодам.

В основу автомобиля легло укороченное шасси «Калины», а двигатель под капотом стоял с увеличенным рабочим объемом — двухлитровый. По словам разработчиков, максимальная скорость достигала 200 км/ч, а первую «сотню» спортивная Lada разменивала за 9 секунд. Родстера был оснащен складной крышей, которая управлялась электроприводом и в сложенном виде не отнимала полезный объем багажника. Несмотря на детальную проработку кузова и салона, машина так и осталась в единственном экземпляре.

Новая классика

ВАЗовская классика стала одним из рекордсменов по длительности конвейерной жизни не только в нашей стране, но и в мире. Однако этот срок мог оказаться не предельным. На АвтоВАЗе вынашивали план продления конвейерной жизнь классического семейства. Именно с этой целью был создан проект ВАЗ-2151, также известный под именем Lada Classic. Машина представлял собой концептуальный универсал на шасси ВАЗ-2105 с более современным и трансформируемым салоном. У автомобиля был громадный 500-литровый багажник и складные задние сиденья, а классическое шасси модернизировали с использованием реечного рулевого механизма, передней подвески МакФерсон и мотора объемом 1,7 л от «Нивы». Позже появилась еще одна вариация на ту же тему — проект седана ВАЗ-2107М с именем Classic-2. Но в обоих случаях дело ограничилось лишь выставочными экземплярами, классическая платформа была признана неперспективной для дальнейшего развития.

Ока-2

Микролитражка «Ока», появившаяся еще в далеком 1987 году, к началу нулевых считалась безнадежной устаревшей и непригодной для дальнейшей модернизации. Поэтому на АвтоВАЗе всерьез работали над созданием второго поколения автомобиля. Первый прототип новой «Оки» вазовцы представляли еще в конце 1990-х, но тогда дальше сомнительного дизайнерского макета дело не пошло. Вариант 2003 года имел более товарный вид и обладал куда большими шансами попасть на конвейер. Новый хэтчбек с заводским индексом ВАЗ-1121 получился больше оригинальной «Оки» и строился уже на агрегатах «восьмерки» с четырехцилиндровыми моторами и неплохим набором оборудования. Прототипы были очень близки к серийным машинам, но в 2004 г. году после смерти главного идеолога проекта гендиректора ВАЗа Виктора Полякова от производства отказались в пользу семейства «Калина».

Проект С

Проект C был самой важной и долгоиграющей разработкой АвтоВАЗа в начале двухтысячных. В 2005 году после прихода на завод менеджеров из «Ростехнологий» в Тольятти решили создать абсолютно новую платформу для целого семейства автомобилей, включая седан, хэтчбек, универсал, кроссовер и даже спорткар. Однако первым показали седан «Силуэт» (ВАЗ-2116), который не только шагнул в D-класс, где продукция АвтоВАЗа никогда не выступала ранее, но и продемонстрировал новый дизайнерский стиль марки, саму платформу с иным шасси и двигателями объемом 1,8 л (116 и 122 л. с.), а также новую коробку передач. Впрочем, войти в новый класс с собственной разработкой АвтоВАЗу так и не было суждено. Через несколько лет проект перспективной платформы был окончательно свернут из-за разразившегося экономического кризиса и нового формата партнерства с альянсом Renault-Nissan.

Lada C-concept и C-Cross

Эти два прототипа, по сути, были продолжением проекта С, который так и не стал серийным. И, пожалуй, C-concept был одним из самых ярких концепт-каров, созданных на АвтоВАЗе до прихода Стива Маттина. Спортивная трехдверка, увидевшая свет в 2007 году, по дизайну превзошла даже самых передовых европейский машин этого класса. И это не голословное утверждение, а реакция публики на Женевском автосалоне, где был представлен автомобиль. Машина была построена на новой платформе, созданной в рамках проекта С и получила перспективный 2,0-литровый мотор, сочетающийся с механикой. По расчетам разработчиков разгон до «сотни» должен был укладываться в 8 с, а «максималка» переваливала за 210 км/ч.

Год спустя после дебюта C-concept в Москве представили прототип городского кроссовера Lada C-Cross с индексом ВАЗ-2119, который также базировался на новом шасси и демонстрировал яркий спортивный стиль. Но ни одна из машин в рамках проекта С так и не стала серийной, поскольку работа над платформой была свернута. Впрочем, некоторые наработки проекта С впоследствии были использованы в работе над семейством Lada Vesta.

Иванова Лада Анатольевна | Роддом №10

 

Врач-акушер-гинеколог, врач организатор здравоохранения, специалист высшей квалификационной категории, кандидат медицинских наук. Имеет более 50 печатных научных публикаций, методических и научно-популярных работ.

В течение 6 лет руководит роддомом №10. Под ее руководством СПбГБУЗ «Родильный дом №10» был награжден Почетным дипломом II степени в 2013 и 2014 годах, а в 2015 году Почетным дипломом I степени «За достижение наилучших показателей эффективности реализации территориальной программы ОМС в группе «Родильный дом». Проводит научные исследования. Является организатором программы по ведению беременности и родов у несовершеннолетних - «Маленькая мама», где с молодыми мамами работают психологи, юристы, социальные работники. Программа утверждена Комитетом по здравоохранению и успешно реализуется на базе СПб ГБУЗ «Родильный дом № 10».

С 2015 года является Членом Санкт-Петербургской Епархиальной Комиссии по вопросам семьи, защиты материнства и детства. С 2016 года Член Общественного Совета Администрации Красносельского района Санкт-Петербурга.

Автор благотворительного интернет-проекта «История родов» по пропаганде здорового образа жизни и ценности материнства. Имеет Благодарность Администрации Красносельского района Санкт-Петербурга «За профессионализм и ответственность при осуществлении деятельности в сфере защиты детей-сирот и детей, оставшихся без попечения родителей» и Благодарность от Управления ГИБДД ГУ Внутренних дел по г. СПб и ЛО «За оказанную помощь в подготовке сотрудников ГИБДД по медицинской подготовке в оказании первой доврачебной помощи». За труд была неоднократно отмечена Благодарностями и Почетными грамотами. Среди них Благодарность Губернатора Санкт-Петербурга, Благодарность Комитета Государственной Думы по труду, социальной политике и делам ветеранов «За большой личный вклад в организацию и оказание медицинской помощи в области охраны материнства и детства в городе Санкт-Петербурге» в 2017 году, Почетными грамотами за многолетний добросовестный труд Комитета по здравоохранению Санкт-Петербурга в 2015 году, Государственной Думы РФ 2016.

С 2016 года - доцент кафедры общественного здоровья и управления здравоохранения СЗГМУ им. Мечникова. Имеет восьмилетний стаж преподавательской работы со студентами и врачами постдипломного обучения.

По итогам конкурса она была выбрана "Женщиной года - 2018" в номинации «Медицина».

Статистика АЕБ | Топ-25 моделей

Модель Январь – июнь % Июнь %
2021 2020 2021 2020
1 Лада Гранта 71 208 49 922 43% 14 133 11 478 23%
2 Лада Веста 57 031 42 615 34% 11 932 8 442 41%
3 Kia Rio 44 750 36 164 24% 6 434 7 873 -18%
4 Hyundai Creta 38 800 29 554 31% 7 315 6 417 14%
5 Hyundai Solaris 33 541 18 444 82% 7 206 3 811 89%
6 Лада 4x4 30 108 19 439 55% 5 399 4 232 28%
7 Volkswagen Polo 28 527 21 341 34% 6 080 4 991 22%
8 Skoda Rapid 23 309 1 760 1224% 4 922 1 533 221%
9 Лада Ларгус пасс. 21 053 15 527 36% 3 982 3 376 18%
10 Renault Duster 19 715 12 086 63% 4 875 2 557 91%
11 Toyota RAV 4 19 103 16 057 19% 2 662 2 635 1%
12 Volkswagen Tiguan 18 938 13 448 41% 3 563 2 152 66%
13 Renault Logan 16 826 12 170 38% 2 548 2 208 15%
14 Kia K5 15 276 - 3 343 -
15 Toyota Camry 14 916 11 366 31% 3 294 2 084 58%
16 Kia Sportage 14 422 10 872 33% 1 971 2 104 -6%
17 Лада ИксРэй 13 882 8 651 60% 2 698 1 772 52%
18 Renault Sandero 13 565 10 927 24% 2 068 2 466 -16%
19 Skoda Karoq 11 347 4 973 128% 2 426 1 737 40%
20 Skoda Kodiaq 11 251 8 728 29% 1 856 1 497 24%
21 Renault Kaptur 10 147 8 537 19% 1 757 1 804 -3%
22 Nissan Qashqai 9 654 10 281 -6% - -
23 Kia Seltos 9 613 4 010 140% 2 100 1 415 48%
24 Mazda CX-5 9 610 8 849 9% - -
25 Renault Arkana 9 354 7 236 29% 1 889 1 609 17%

все банки в одном месте

LADA Promo

от 10,9 %

Легковой автомобиль

ежемес. платежот 9 807 ₽

до6,5 млн ₽

от 10%от 50 000 ₽

Стаж работы от 3 мес. на последнем месте

Регистрация постоянная

LADA Finance Special

11,25 %

Легковой автомобиль

ежемес. платежот 9 857 ₽

до4,9 млн ₽

от 20%от 100 000 ₽

Необходимость страхования каско, финансовая и страховая защита

Стаж работы от 4 мес. на последнем месте

Регистрация постоянная

Кредит с остаточным платежом Lada

от 11,6 %

Легковой автомобиль

ежемес. платежот 9 907 ₽

до3,5 млн ₽

от 20%от 100 000 ₽

Необходимость страхования каско

Стаж работы от 3 мес. на последнем месте

Регистрация постоянная

Lada

от 12,2 %

Легковой автомобиль

ежемес. платежот 9 992 ₽

до2 млн ₽

от 10%от 50 000 ₽

Необходимость страхования каско

Стаж работы от 3 мес. на последнем месте

Регистрация постоянная

LADA Promo (ДМС)

от 10,9 %

Легковой автомобиль

ежемес. платежот 9 807 ₽

до6,5 млн ₽

от 10%от 50 000 ₽

Необходимость страхования дмс

Стаж работы от 3 мес. на последнем месте

Регистрация постоянная

LADA Finance Super

от 11,49 %

Легковой автомобиль

ежемес. платежот 9 891 ₽

до4,9 млн ₽

от 0%от 0 ₽

Необходимость страхования каско, финансовая и страховая защита

Стаж работы от 4 мес. на последнем месте

Регистрация постоянная

Lada с пробегом

от 12,9 %

Легковой автомобиль

ежемес. платежот 10 093 ₽

до2 млн ₽

от 20%от 100 000 ₽

Необходимость страхования каско

Стаж работы от 3 мес. на последнем месте

Регистрация постоянная

Спецусловия для Lada

15,5 %

Легковой автомобиль

ежемес. платежот 10 473 ₽

до1,5 млн ₽

от 10%от 50 000 ₽

Стаж работы от 3 мес. на последнем месте

Регистрация постоянная

LADA Finance Light

11,49 %

Легковой автомобиль

ежемес. платежот 9 891 ₽

до4,9 млн ₽

от 20%от 100 000 ₽

Необходимость страхования каско, финансовая и страховая защита

Стаж работы от 4 мес. на последнем месте

Регистрация постоянная

LADA Finance (СЖ)

от 12,5 %

Легковой автомобиль

ежемес. платежот 10 036 ₽

до6,5 млн ₽

от 10%от 50 000 ₽

Необходимость страхования каско, страхование жизни

Стаж работы от 3 мес. на последнем месте

Регистрация постоянная

Обучение игре на грифе | Мир уроков игры на гитаре


Изучение грифа - это задача, которую этот урок поможет вам эффективно решить. Знаете ли вы, что гитара с 22 ладами содержит 138 нот? Это огромная задача, которая бросает вызов как начинающим, так и опытным гитаристам. Этот урок расскажет вам, почему некоторые люди учат его неправильно (неэффективно и скучно).

Почему вы должны изучать гриф

Вы должны изучить гриф по одной простой причине.Вы хотите играть быстрее!

Обычно, когда люди говорят о скорости, они говорят о физических аспектах обучения игре на гитаре. Обычно я думаю о шредерах, прокладывающих путь к безумным потокам нот. Измельчение требует много практики, но это другой тип скорости.

Когда вы учитесь играть на грифе, вы играете быстрее, потому что можете мгновенно вспомнить ноту. Мгновенный вызов позволяет как можно быстрее найти и сыграть любую ноту. Это скорость mental , которая позволяет вам решать, находить и играть быстрее.

Почему изготовление грифа не работает

Большинство гитаристов утверждают, что знают гриф, потому что могут найти любую ноту. Многие песни имеют темп 120 ударов в минуту, что составляет 2 секунды на такт.

  • Вся нота = 2 секунды
  • Половинная нота = 1 секунда
  • Четвертная нота = 1/2 секунды
  • Восьмая нота = 1/4 секунды
  • Шестнадцатая нота = 1/8 секунды

Вам нужно вспоминать заметки за доли секунды! Вот почему умение найти любую заметку не работает.Без мгновенного вспоминания вы не сможете успевать!

Как научиться играть на грифе

Научиться играть на грифе несложно, но требует практики. Большинство гитаристов находят эту задачу скучной, потому что они выучили ее неправильно. Вдобавок они пытаются использовать ярлыки, которые не работают! Лучший способ научиться играть на грифе - использовать несколько способов запоминания ноты. Это не только интереснее, но и эффективнее.

Ассоциации использования

Человеческий мозг запоминает с помощью ассоциаций.Когда вы играете ноту, вы думаете о ноте, которую хотите. Вы находите это на грифе. Вы слышите записку. Вы видите гриф. Все эти предметы можно связать друг с другом, чтобы сформировать многомерные упражнения. Позже я дам вам упражнения, которые объединят то, что вы видите, слышите и чувствуете, чтобы максимально повысить вашу эффективность.

Практика запоминания

Вы когда-нибудь готовились к экзамену и забыли то, что вы узнали? Когда вы попытаетесь выучить гриф, вы забудете об этом. Ваш мозг переводит вашу краткосрочную память в долгосрочную, когда вы спите.Я рекомендую практиковаться на грифе по 10-20 минут в день, пока вы не осознаете это.

Избегайте этих методов

Вот список неэффективных или скучных способов обучения игре на грифе. Это мой список антирекомендаций.

  • Не пытайтесь визуально запомнить изображение нот на грифе. Это, наверное, самый скучный метод, и вы не связываете звук
  • Не пытайтесь сократить путь, разучивая только лады 1–12. Лады 13+ расположены ближе друг к другу, поэтому ощущается по-другому, и они имеют более высокую высоту звука.Мгновенный отзыв требует умственного и физического отзыва !
  • Не ограничивайтесь 5 th и 6 th Многие гитаристы разучивают эти две струны и извлекают остальные ноты. Это просто недостаточно быстро.
  • Не практикуйте слишком много нот за одно занятие. Большинство людей могут запомнить около 7 пунктов за один присест без особых дополнительных усилий. Как ни странно, существует семь естественных названий нот (A, B, C, D, E, F, G). Я рекомендую сначала заняться ими.

Что нужно знать перед началом практики

В этом разделе я дам вам необходимую информацию.

Нумерация строк и стандартная настройка

Струны пронумерованы от самой тонкой струны (1-я струна) до самой толстой (6-я струна). Настройка дается от 6-й до 1-й струны: E-A-D-G-B-E. Эта настройка (E-A-D-G-B-E) называется стандартной настройкой.

Ноты названы с использованием первых семи букв алфавита, однако на гитаре воспроизводится более семи высот или нот.Названия нот или буквы повторяются. Например: название банкноты
после G - A:… E-F-G-A-B-C-D-E-F-G-A-B-C…

Нумерация ладов

Лады нумеруются от грифа к корпусу, начиная с 1. Иногда цифра 0 или буква O используется для обозначения открытой струны или струны, на которой играется без ударов ноты.

Фреттинг ноты выполняется нажатием на струну за ладом (со стороны грифа лада).

Механизм накладки грифа

Гитаристы могут перемещаться по грифу горизонтально вверх и вниз, а также вертикально поперек грифа.Это общие термины, используемые для обозначения того, как перемещать руки при игре на гитаре.

Расположение нот на грифе

В этом разделе показано, где можно сыграть каждую ноту на гитаре. Обозначения даны для полноты картины. У меня есть урок по чтению стандартных обозначений и табулатур, если вам нужна дополнительная информация.

Ноты первой струны (High E String)

Ноты второй струны (струна B)

Ноты третьей струны (G String)


Ноты четвертой струны (струна D)

5-я струна (струна)

Шестая струна (E струна)

Обозначение всех нот

Следующие обозначения и табулатура показывают полный диапазон гитары в стандартной настройке.

Некоторые ноты можно воспроизводить только в одном месте, в то время как другие можно играть не более чем в 5 местах.

Упражнения по восходящей и нисходящей

Это простые упражнения, но вы хотите попробовать несколько вещей во время их выполнения.

  • Скрывайте табулатуру во время игры. Показывать только обозначения (чтобы не обмануть).
  • Не используйте один палец для всех заметок. Найдите как можно меньше сдвигов рук.
  • Вы заметите, что я использовал четвертные ноты для B-C и E-F.Это полутона друг от друга. Я использовал половинные ноты, когда интервал составляет целый шаг (2 полутона). Это должно усилить различные интервалы.
  • Произнесите ноты во время игры, чтобы связать имя с нотой.
  • Наблюдайте за своей беспокойной рукой, когда вы говорите, и играйте по нотам.
  • Слушайте записи. Постарайтесь запомнить их звук вместе с чувством беспокойства в этой позе.
  • Попробуйте слушать с закрытыми глазами и не отрывая глаз от ладов.
  • Обратите внимание, как точки на грифе соответствуют каждой ноте.
  • Используйте метроном со скоростью 60 ударов в минуту (1 секунда на долю). Каждый раз увеличивайте скорость на 20 ударов в минуту. Посмотрите, как быстро вы сможете играть чисто. Если вы становитесь небрежным, действуйте медленнее, чтобы не сформировать вредных привычек.

Ноты шестой строки по возрастанию

Я рекомендую переместить руку из открытого / первого положения в 5-ю, 10-ю, 15-ю и 19-ю позиции. Не стесняйтесь пробовать другие смены рук, чтобы изменить это.

Ноты шестой струны по убыванию

Еще раз попробуйте разные положения ручного переключения передач.

Мажорные аккорды, укорененные в 6-й струне

Ноты пятой строки по возрастанию

Ноты пятой струны по убыванию

5-я струна мажорных аккордов по возрастанию

Сыграйте эти аккорды по возрастанию, а затем по убыванию.

Прочие упражнения для восхода и спуска

Я оставлю эти на ваше усмотрение, что само по себе является отличным умственным упражнением.

  • Вы заметите, что я использовал мажорные аккорды в форме ми и ля.Попробуйте сыграть последовательность диатонических аккордов в тональности C: CMaj, Dm, Em, FMaj, GMaj, Am, Bdim. Например, замените EMaj на Em. Хотя диатоническая гармония - это отдельная тема, я определяю ее для этих упражнений как аккорды, в которых используются ноты мажорной гаммы. В данном случае гамма до мажор.
  • Измените аккорды на диатонические септаккорды в тональности C из форм E и A: CM7, Dm7, Em7, FM7, G7, Am7, Bm7b5.
  • Поскольку аккорды состоят из третей (мажорная и малая третьи интервалы), попробуйте сыграть третями (каждую вторую ноту на струне), чтобы вы знали ноты аккорда вдоль струны.Это работает для всех диатонических аккордов в тональности. Для примера возьмем ми минор 7: E- (пропустить F) -G- (пропустить A) -B- (пропустить C) -D. Ноты Em7 - это E G B D. Если вы хотите Em, пропустите последнюю ноту. Обожаю это упражнение. Он учит сразу многим нюансам музыки.

Еще упражнения

Вот лишь несколько дополнительных упражнений, которые вы можете использовать.

  • Сыграйте ноту, затем сыграйте ее октаву на той же струне (на 12 ладов вверх). Повторите это для всех нот.
  • Сыграйте ноту, затем сыграйте ту же ноту на соседней строке.Пример. A на 5-й струне, открытая; А на 6-й струне, 5-м ладу.
  • Сыграйте ноту, затем сыграйте ее октаву на соседней струне. Пример E на 6-й струне, открытая; E на 5-й струне, 7-м ладу.
  • Сыграйте ноту, затем сыграйте ее октаву на расстоянии двух струн. Пример: E на 6-й струне, открытая; E на 4-й струне, 2-м ладу. Обратите внимание, как эти октавы используются в известных вам аккордах.
  • Сыграйте аккорд и определите основные ноты в этом аккорде.

Есть намного больше упражнений, поэтому я предлагаю книгу, чтобы все это организовать, чтобы вы могли быстро сосредоточиться на изучении грифа! Он содержит 159 упражнений, чтобы ваши практические занятия были свежими.Он включает в себя теорию музыки, аккорды и многое другое, поэтому вы изучаете несколько концепций одновременно. Я до сих пор использую эти упражнения, чтобы оставаться свежей. Они работают от новичков до профи. Подумайте о покупке моей книги The Secrets of Learning the Fretboard !

Последние мысли

Надеюсь, вам понравился этот урок по обучению игре на грифе. Требуется много практики, но оставаться мотивированным - проблема №1. Есть много интересных способов попрактиковаться в игре на гитаре. Разнообразные упражнения - это лучший способ сохранить свою практику свежей.Как только вы это сделаете, вы вырветесь из колеи и получите гораздо больше удовольствия от игры на гитаре!

Если этот урок вам помог, пожалуйста, поставьте лайк на моей новой странице на Facebook и подумайте о том, чтобы рассказать о том, как он помог вам.

Пентатоническая шкала D нота. Научитесь играть пентатонические гаммы


Уроки игры на гитаре, которые работают!

Добро пожаловать в Guitar Secrets
Уроки игры на гитаре, которые работают!

[Пятая корень пентатоники минор] [Пентатоника C нота Am] [Пентатоника Am на D]
[Пентатоника Am на E] [Пентатоника Am на G] [Корень Am пентатоники 17]
[Пентатоника Am открытая позиция] [Я у G]

Напомним, что ноты пентатоники ля минор: A C D E и G.

На первом изображении ниже показаны гитарные ноты, составляющие пентатонику ля минор, начиная с 10-го лада, позиция ноты D. Примечания следующие: D-E, G-A, C-D, E-G, A-C и D-E.

На втором изображении ниже показан образец аппликатуры для пентатоники ля минор, начиная с ноты D на 10-м ладу. Используется аппликатура 1-3, 1-3, 1-3, 1-4, 1-4, 1-3.

Это действительно начинает становиться интенсивнее, но все, что вам нужно помнить, это то, что каждая позиция пентатоники ля минор имеет одни и те же ноты.Единственное, что отличается - это положение нот. К настоящему времени вы должны запомнить систему нумерации гитарных аппликатур. Система нумерации еще раз проиллюстрирована ниже.

1 = индекс
2 = средний
3 = кольцо
4 = Пинки
T = большой палец

На рисунке ниже показана пентатоника ля минор, начинающаяся на 10-м ладу, нота D на струне Low E. На втором рисунке ниже показан предлагаемый образец аппликатуры. Когда вы освоитесь с этой схемой аппликатуры, попробуйте приведенные ниже примеры. Пример соло-гитары начинается с 5-го лада и продвигается до 12-го лада.

На рисунке ниже показан образец аппликатуры. Обратите внимание, что вы начинаете с первого пальца на 10-м ладу струны Low E.

Посмотрите на изображение выше. Обратите внимание на рисунок аппликатуры, начинающийся на 10-м ладу.
1-3, 1-3, 1-3, 1-4, 1-4, 1-3.

Табулатура для игры на 10-м ладу показана ниже.

На изображении ниже показан тот же образец пентатоники А минор, что и выше, но с нотами и их расположением.Помните, что играйте слева направо, от Low E до High E и чередуйте звукосниматель вниз, а затем вверх. Затем продвигайтесь обратно вверх от высокой струны ми к нижней струне ми.

Послушайте это от D до D

Вот пример использования этой позиции. Начинается с основной ноты 5-го лада и работает до позиции 8-го лада, а затем до положения 10-го лада.

Этот гитарный рифф в основном такой же, как и тот, что вверху справа, но остается на месте. Была добавлена ​​одна нота в конце рифа из гаммы блюза. Это примечание было обведено.

Несмотря на то, что мы начинаем с ноты D, вы должны заметить, что нам не нужно начинать с этой ноты. Мы можем начать с ноты A, C ноты или любого аккорда, который мы играем. Ноты аккорда Am - это A C и E. Вы можете сыграть соло поверх аккорда Am, как показано выше. Вы также можете сыграть здесь аккорд C. Ноты аккорда C - это C E и G. Вы также можете играть поверх аккорда Dm или D9, D5 и других.

Вот почему так важно выучить каждую позицию пентатоники Am. Вы можете сыграть каждый аккорд этой гаммы в любой позиции гитары. Это станет яснее по мере нашего продвижения.

Назначение:

  1. Используйте эти иллюстрации на пустом грифе, чтобы заполнить ноты позиции D пентатоники ля минор на позиции 10-го лада.
  2. Заполните одну иллюстрацию пальцев, используемых в позиции D пентатоники ля минор.
  3. Заполните одну иллюстрацию нот, используемых для позиции D пентатоники ля минор.

Попрактикуйтесь в этой позе аппликатуры несколько сотен раз. Следующая позиция, которую нам нужно выучить, будет начинаться с 12-й позиции пентатоники ля минор. Эта позиция будет начинаться с ноты E на 12 ладу.

Удачи,

Guitar Secrets

Произошла ошибка при настройке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности.Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки вашего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, используйте кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в cookie-файлах может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

Разработка генетически кодируемой системы FRET с использованием флуоресцентных РНК-аптамеров

Синтез YO3-ацетата

Et 3 N (0.26 мл, 1,86 ммоль, 1 экв.) Добавляли к перемешиваемому раствору 4 - [( E ) -2- (ацетилфениламино) этенил] -1-метилхинолиния йодида 28 (790 мг, 1,84 ммоль, 1 экв. ) и 2- (2-метилбенз [ d ] оксазол-3-ил-3-ил) ацетат 42 (500 мг, 2,62 ммоль, 1,42 экв.) в DCM. Раствор оставляли перемешиваться на 20 ч с последующим концентрированием в вакууме. Затем твердое вещество ресуспендировали в DCM (150 мл), фильтровали и промывали ацетоном (3 × 10 мл). Твердое вещество сушили в вакууме с получением (85 мг, 12%) YO3-ацетата в виде аморфного твердого вещества пурпурного цвета. 1 H ЯМР (400 МГц, ДМСО- D6 ) δ 10,17 (с, 1H), 8,47-8,38 (м, 2H), 8,34-8,28 (м, 1H), 8,24-8,18 (м, 1H), 8,18–8,13 (м, 1H), 7,94–7,87 (м, 2H), 7,68–7,59 (м, 3H), 7,52–7,46 (м, 1H), 7,41–7,28 (м, 3H), 7,01–6,94 (м , 1H), 5,91–5,82 (м, 1H), 4,47 (с, 2H), 4,05 (с, 3H). HRMS (ESI) [M + , C 22 H 19 N 2 O 3 + ] требует м / z 359,1390, найдено 359,1395.

YO3 PEG 3-звенный синтез биотина амина

HBTU (45 мг, 3 экв.) И DIPEA (30 экв.) Добавляли к YO3-ацетату (3 мг, 1 экв. ) В ДМФ (250 мкл).Раствору давали перемешиваться в течение 10 минут, после чего добавляли N -биотинил-3,6,9-триоксаундекан-1,11-диамин 43 (7 мг, 2 экв.) И раствор перемешивали в течение 18 часов. . Растворитель лиофилизировали и остаток повторно растворяли в 1: 1 MeCN / 50 мМ NH 4 OAc (водн.) . Затем раствор очищали с помощью ОФ-ВЭЖХ (25–50% MeCN против 50 мМ NH 4 OAc за 30 мин). RP-HPLC Rt = 14,9 мин. HRMS (ESI) [M + , C 40 H 51 N 6 O 7 S + ] требуется м / z 759.3534, обнаружено 759,3531.

Структурное моделирование РНК

Трехмерный (3D) дизайн базовой структуры оригами 2H-AE РНК был подробно описан ранее 24, 44 . Вкратце, с помощью программ 3D-моделирования Swiss-PdbViewer 45 и UCSF Chimera 46 две стандартные двойные спирали РНК А-формы были выровнены параллельно и повернуты, чтобы создать оптимальное расстояние для антипараллельного равномерного (AE) двойного кроссовера (DX). ). Внутренняя 180 ° целующаяся петля (DIS ВИЧ-1, PDB id: 2B8R) была расположена между кроссоверами, а тетрапетли UUCG (извлеченные из PDB id: 1F7Y) были расположены на концах двойных спиралей.Трехмерный дизайн конструкций apta-FRET был основан на структуре оригами 2H-AE РНК. Минимальное ядро ​​аптамера шпината (PDB id: 4Q9R), ранее использовавшееся для создания Bunch of Baby Spinach 47 , было расположено на одном из внешних доменов двойной спирали, фланкирующих DX. Мотив шпината был повернут так, чтобы направить дипольный момент DFHBI-1T либо непосредственно в сторону, либо от соседнего параллельного домена двойной спирали, где должен был быть расположен аптамер манго. Ядро исходного аптамера шпината фланкируется двумя доменами с двойной спиралью, называемыми P1.2 и P2.1 Хуанг и др. 31 Это позволяет два разных варианта включения; «нормальная» версия, в которой домен P1.2 использовался для соединения шпината с РНК-оригами, и «перевернутая» версия (помеченная *), где домен P2. 1 использовался для соединения шпината с РНК-оригами. Стебель-петля, построенная из стандартной двойной спирали А-формы и тетрапетли UUCG, была прикреплена к другому концу ядра шпината. Из-за стерических столкновений только две из четырех возможных версий оказались жизнеспособными; нормальная версия с диполем, направленным к соседней двойной спирали, и перевернутая версия с диполем, направленным от соседней двойной спирали.Недавно опубликованная сокристаллическая структура аптамера манго выявила трехуровневый G-квадруплекс, связанный с доменом двойной спирали через тетрапетлевый мотив GAAA, и не позволяет манго «переворачивать», как шпинат. Связь между тетрапетлей и G-квадруплексом структурно не определена и, как ожидается, будет гибкой, а TO3-биотин (очень похож на YO3-биотин) не может быть смоделирован в связывающем кармане без стерических столкновений. Следовательно, мы не смогли смоделировать точное положение диполя флуорофора YO3-биотина.Чтобы найти оптимальное положение Mango, длина домена двойной спирали между Mango и ближайшим DX варьировалась с шагом в две пары оснований. На некоторых позициях были стерические столкновения. После первоначального моделирования 3D-структуры были лигированы с помощью Perl-скрипта («ligate.pl», который доступен на нашей веб-странице www.andersen-lab.dk) и уточнены с помощью функции рекурсивного геометрического уточнения в Assemble2 48 . 3D-модели в этой работе были визуализированы в UCSF Chimera.

Расчет дипольного момента

Дипольный момент DFHBI-1T был рассчитан с использованием пакета программ Marvin (версия 15.10.19) и плагин Calculator, разработанный ChemAxon (http://www.chemaxon.com/). Химическая структура DFHBI-1T была нарисована в MarvinSketch, а состояние протонирования молекулы было определено при pH 7,8 с использованием подключаемого модуля pKa Calculator. Дипольный момент наиболее распространенных микровидов DFHBI-1T (70,4% при pH 7,8) был рассчитан с использованием подключаемого модуля Dipole Moment Calculator. Полный дипольный момент DFHBI-1T был визуализирован как вектор, выраженный в системе координат главной оси. Полученный файл, показывающий как химическую структуру, так и вектор дипольного момента DFHBI-1T, был экспортирован как файл pdb и импортирован в Swiss-PdbViewer 45 для выравнивания молекулы флуорофора с трехмерными координатами DFHBI из кристаллической структуры шпината (PDB id : 4Q9R).

Дизайн последовательности РНК

Процесс создания последовательности был подробно описан ранее 24, 44 . Вкратце, 3D-модели были загружены в Assemble2 48 для визуализации вторичной структуры, которые были вручную перенесены в текстовые файлы проекта 2D-структуры. Для apta-FRET с разветвленным KL мотив Т-образного соединения был создан в 2D-схеме путем замены двух выпуклых аденинов в одном из партнеров петли поцелуя на петлю-ножку. Последовательность консервативных мотивов РНК (KL, тетрапетли, шпинат, манго, РНК-захватчик) была сохранена, а оставшаяся последовательность была обозначена Ns.Каждая последовательность была дополнительно ограничена путем «блокировки» кроссоверов парами оснований GC, включения пары колебаний GU на каждые восемь непрерывных пар оснований и ограничения 5'-конца 5'-GGGAGA-3 ', оптимальной инициирующей последовательностью для T7. РНК-полимераза. 2D-чертежи были прочитаны сценарием Perl («trace.pl», который доступен на нашей веб-странице www.andersen-lab.dk), который выводит обозначение точечных скобок и ограничения последовательности, подходящие для проектирования последовательности в NUPACK 49 . Последовательности, разработанные в NUPACK, были свернуты и оценены с использованием mFold 50 .

Синтез ДНК-матриц

ДНК-матриц конструкций apta-FRET получали стандартной ПЦР-амплификацией фрагментов гена gBlocks из IDT с использованием ДНК-полимеразы Phusion High-Fidelity (ThermoFischer Scientific). Амплификации выполняли в 1 × буфере Phusion HF (предоставленном производителем), 200 мкМ dNTP (invitrogen), 1 мкМ прямого (Fwd) и обратном (Rev) праймерах (заказанных у IDT), 4 нг gBlock и 1 ед. Полимеразы Phusion. ДНК-матрицы простых аптамеров получали стандартной ПЦР-амплификацией ДНК-ультрамеров (IDT) с использованием ДНК-полимеразы Taq (Invitrogen).Амплификации выполняли в буфере 1 × Taq , 200 мкМ dNTP (invitrogen), 1,5 мМ MgCl 2 , 1 мкМ праймеров Fwd и Rev, 4 нг ультрамера и 2,5 мкМ ДНК-полимеразы Taq U . Праймеры Fwd и Rev были разработаны для каждой матрицы (см. Дополнительное примечание 2), а температуры отжига были рассчитаны с использованием калькулятора New England Biolabs (NEB) T m (http://tmcalculator.neb.com/). Амплифицированную ДНК очищали с использованием набора для очистки ДНК GFX PCR (иллюстрация) и хранили в буфере ТЕ.

Транскрипция in vitro и очистка РНК

Транскрипция in vitro выполнялась путем смешивания ДНК-матрицы, транскрипционного буфера (15 мМ Mg (OAc) 2 , 50 мМ трис-ацетат pH 7,8, 40 мМ NaCl, 0,1% Tween20) , 1 мМ DTT и NTP (по 2,5 мМ каждый). Добавляли РНК-полимеразу Т7 (собственного производства), и образцы инкубировали при 37 ° C в течение не менее 4 часов. Реакцию останавливали, добавляя ДНКазу I (ThermoFischer Scientific) до концентрации 1 ед. / 100 мкл и инкубируя при 37 ° C в течение 15 мин.Транскрибируемую РНК очищали на 6% полиакриламидных гелях после смешивания 1: 1 с денатурирующим загрузочным буфером (95% формамид, 18 мМ EDTA, 0,025% SDS, бромфеноловый синий, ксилолцианол) и нагревания до 95 ° C в течение 5 минут. Полосы геля визуализировали с использованием УФ-затенения, вырезали из геля и элюировали в течение ночи в не содержащей нуклеазы H 2 O (Ambion). Кусочки геля отделяли от жидкости с использованием спин-колонок для экстракции ДНК из геля Freeze'n'Squeeze (Bio-Rad), и, наконец, РНК осаждали этанолом, ресуспендировали в свободной от нуклеаз H 2 O и хранили при -20 ° C. .

Тепловой отжиг структур РНК оригами

Транскрибированная РНК была подвергнута тепловому отжигу перед использованием, чтобы гарантировать правильное сворачивание структур РНК оригами. Сначала РНК в свободной от нуклеаз H 2 O нагревали до 95 ° C в течение 5 минут, а затем быстро охлаждали при -20 ° C в течение 3 минут. Затем добавляли 5 × буфер для сборки (5 × TB, 625 мМ KCl, 5 мМ MgCl 2 ) до конечной концентрации 1 ×, и образцы оставляли при 37 ° C на 30 мин.

Измерения флуоресценции

Измерения флуоресценции проводили на FluoroMax 4 от Horiba, Jobin Yvon. Возбуждение DFHBI-1T и YO3-биотина проводили при 450 нм и 580 нм соответственно. Эмиссия DFHBI-1T и YO3-биотина регистрировалась при 503 нм и 620 нм соответственно. Щели монохроматора были установлены на 5 нм, а время интегрирования составляло 0,2 с. Измерения проводились на объемах образцов от 65 до 100 мкл, и использовались концентрации флуорофора 1 мкМ DFHBI-1T и 1,7 мкМ YO3-биотина, если не указано иное. Относительные значения FRET были рассчитаны с использованием уравнения \ ({\ rm FRET} = \ frac {{I _ {\ rm {DY}} (ex _ {\ rm D}, em _ {\ rm Y})}} {{I _ {\ rm {DY}} (ex _ {\ rm D}, em _ {\ rm Y}) + I _ {\ rm {DY}} (ex _ {\ rm D}, em _ {\ rm D})}} \), где I DY ( ex D , em Y ) - это излучение на длине волны YO3-биотина после возбуждения DFHBI-1T и I DY ( em D ) - излучение на длине волны DFHBI-1T после возбуждения DFHBI-1T.Оба были измерены с присутствием DFHBI-1T и YO3-биотина.

Анализы связывания флуорофора и конкуренции

Анализы активации и конкуренции флуорофора проводили на структурах РНК-оригами, содержащих только шпинат или только манго, или с пустой структурой 2H-AE (дополнительное примечание 1). Конструкции были подвергнуты тепловому отжигу перед измерениями в соответствии с протоколом выше. Концентрации как РНК, так и флуорофоров указаны на соответствующих рисунках. Измерения проводились в 1 × сборочном буфере.

Fluorophore EC

50 измерения

Были измерены аффинности связывания с различными флуорофорами аптамеров, интегрированных в структуры оригами РНК. Конструкции перед использованием подвергали тепловому отжигу в соответствии с описанным выше протоколом, и образцы готовили в 1-кратном буфере для сборки. Измерения проводились с использованием серийно разведенных флуорофоров в концентрациях от 1 нМ до 2 мкМ. Все образцы готовили в трех экземплярах как с 20 нМ РНК, так и без нее, и флуоресценцию измеряли на VarioSkan Flash Reader (Thermo Scientific) путем возбуждения образцов, содержащих DFHBI-1T или YO3-биотин, при 450 нм или 580 нм, соответственно. Фоновую флуоресценцию от каждой концентрации флуорофора в отсутствие РНК вычитали из записанных интенсивностей перед расчетом ЕС 50 . EC 50 рассчитывали в GraphPad Prism 7.0b для Mac OS X с использованием нелинейного регрессионного анализа «логарифм (агонист) против ответа (три параметра)» кривой доза-ответ.

Измерения усиления флуоресценции

Усиление флуоресценции было рассчитано для флуорофоров в минимальной версии аптамеров и для аптамеров, интегрированных в структуры оригами РНК.В целом, 1 мкМ РНК в 1 × буфере для сборки инкубировали со 100 нМ соответствующего флуорофора. Усиление флуоресценции рассчитывалось с использованием уравнения \ (F _ {\ rm {E}} = \ frac {{I _ {{\ rm {F}} + {\ rm {R}}}}} {{I _ {\ rm {F }}}} \), где I F + R - интенсивность флуоресценции флуорофора в присутствии РНК, а I F - интенсивность флуоресценции одного флуорофора (флуоресценция в выключенном состоянии).

Конформационные изменения в системе apta-FRET

Визуализация конформационных изменений в ответ на захватывающие РНК осуществлялась с помощью измерений с временным разрешением системы apta-FRET, содержащей разветвленный KL.Флуоресценцию как DFHBI-1T, так и YO3-биотина регистрировали каждые 30 с, а между измерениями заслонки закрывали, чтобы избежать обесцвечивания. Обратимая инвазия была достигнута путем добавления сначала РНК-захватчика с фиксатором до конечной концентрации 200 нМ к смеси 100 нМ структуры apta-FRET, 1 мкМ DFHBI-1T и 1,7 мкМ YO3-биотина, а затем добавлением «анти-захватчика». ”До конечной концентрации 400 нМ. Выходы FRET рассчитывались, как описано ранее.

Захватчик 1: UAGCUUAUCAGACUGAUGUUGAUAUAAAAG;

Анти-захватчик 1: CUUUUAUAUCAACAUCAGUCUGAUAAGCUA.

Захватчик 2: CUAGACUGAAGCUCCUUGAGGGAAGUUAG;

Анти-захватчик 2: CUAACUUCCCUCAAGGAG CUUCAGUCUAG.

EC

50 измерения SAM в датчике apta-FRET SAM

Аффинность связывания SAM в датчике S6-M19-SAM проводили путем инкубации с серийно разведенными SAM в концентрациях от 1 мкМ до 2,5 мМ. Измерения проводили в трех повторностях с 50 нМ РНК в буфере для сборки, содержащем 1 мкМ DFHBI-1T и 1,7 мкМ YO3-биотин. Измерения проводились в VarioSkan Flash Reader путем возбуждения образцов при 450 нм и регистрации спектров флуоресценции от 470 до 700 нм.Выходы FRET и EC 50 были рассчитаны, как описано ранее.

Процедура клонирования конструкций apta-FRET

Были выполнены стандартные этапы молекулярного клонирования. Во-первых, амплификацию и кодирование сайтов ограничения ( Bgl II и Eco RI) на концах матриц ДНК проводили с помощью ПЦР-амплификации с использованием ДНК-полимеразы Phusion, как описано выше (см. Дополнительное примечание 2 для последовательностей праймеров). После расщепления с использованием Bgl II и Eco RI (ThermoFischer Scientific - Fastdigest) в течение 30 минут при 37 ° C ДНК очищали с использованием набора для очистки GFX PCR (иллюстрация).pET28c-F30–2xdBroccoli был получен в подарок от Samie Jaffrey (плазмида Addgene № 66843). Плазмиду, полученную в компании на основе плазмиды pET28c, расщепляли с помощью Bgl II и EcoR I и очищали на 1% агарозном геле 0,5 × TBE. Линеаризованную плазмиду pET28c экстрагировали из геля с использованием набора для экстракции геля GFX (иллюстрация), и вставку лигировали в плазмиду в соотношении 1: 3 путем инкубации с ДНК-лигазой Т4 при 16 ° C в течение ночи. Реакционную смесь лигирования использовали непосредственно для трансформации плазмиды в DH5-alfa E.coli (NEB) с использованием стандартной процедуры теплового шока. Трансформированные бактерии высевали на LB-агар с канамицином (Kan, 50 мкг / мл) и инкубировали в течение ночи при 37 ° C. Отбирали отдельные колонии и инокулировали в LB-Kan (50 мкг / мл) в течение ночи при 37 ° C при энергичном встряхивании. Плазмиды выделяли с использованием набора GeneJET для плазмид miniprep (ThermoFischer Scientific) перед проверкой секвенированием в GATC-Biotech. Плазмиды с положительной последовательностью (~ 1 мкг) трансформировали в химически компетентные HT115 (DE3) E.coli собственного производства, а клоны с положительной трансформацией отбирали с использованием чашек с LB-агаром с кан (50 мкг / мл) и тетрациклином (Tet, 12,5 мкг / мл), как описано в Hull and Timmons 51 .

Процедура культивирования и установка

Ночная (ON) культура была получена путем инокуляции отдельных колоний HT115 (DE3) -pET28c-FRET в 3 мл LB с Kan (50 мкг / мл) и Tet (12,5 мкг / мл) и позволили выращивать в аэробных условиях при 37 ° C при интенсивном встряхивании в течение ночи. Культуру разводили 1: 100 в LB-Kan и инкубировали в тех же условиях до OD 600 ~ 0.25–35 (~ 3 ч). Затем к половине образца добавляли IPTG (1 мМ) и инкубировали культуры в течение ~ 6–9 ч. Добавляли DFHBI-1T (50 мкМ) и YO3-биотин (85 мкМ), и культуры инкубировали в течение 30 мин. Различные культуры осаждали центрифугированием при 4000 × g в течение 5 минут перед ресуспендированием в свежей соли 1 × M9 (Sigma # M6030) и анализировали с помощью спектрофлуорометрии, проточной цитометрии или конфокальной микроскопии.

Спектрофлуориметрические измерения

Клетки, приготовленные, как описано выше, анализировали спектрофлуориметрическими измерениями в объеме 50 мкл. Готовили образцы, содержащие как DFHBI-1T, так и YO3-биотин, а также контроли, содержащие только DFHBI-1T или YO3-биотин.Возбуждение DFHBI-1T и YO3-биотина проводили при 450 и 580 нм соответственно. Выходы FRET были рассчитаны путем первого расчета прямого акцепторного возбуждения, которое составило 1,5% (см. Дополнительную таблицу 2) от общего выброса YO3-биотина с использованием уравнения: \ (A _ {\ rm {dir}} = \ frac { {I _ {\ rm {Y}} (ex _ {\ rm {D}}, em _ {\ rm {Y}})}} {{I _ {\ rm {Y}} (ex _ {\ rm {Y}}, em _ {\ rm {Y}})}} \), где \ (I_Y (ex_D, em_Y) \) - это излучение на длине волны YO3-биотина после возбуждения DFHBI-1T с присутствием только YO3-биотина, а I Y ( ex Y , em Y ) - это излучение на длине волны YO3-биотина после возбуждения YO3-биотином, в котором присутствует только YO3-биотин.Далее была найдена интенсивность излучения, возникающего из хвоста DFHBI-1T на длине волны YO3-биотина; он был рассчитан как 7,4% (дополнительная таблица 2) от максимального выброса DFHBI-1T с использованием уравнения: \ (D _ {\ rm {утечка}} = \ frac {{I _ {\ rm {D}} (ex _ {\ rm {D}}, em _ {\ rm {D}})}} {{I _ {\ rm {D}} (ex _ {\ rm {D}}, em _ {\ rm {Y}})}} \) , где I D ( ex D , em D ) - это излучение на длине волны DFHBI-1T после возбуждения DFHBI-1T при наличии только DFHBI-1T, и I ( ex D , em Y ) - это излучение на длине волны YO3-биотина после возбуждения DFHBI-1T с присутствием только DFHBI-1T.\ ast I _ {\ rm {DY}} (ex _ {\ rm {D}}, em _ {\ rm {D}}) + I _ {\ rm {DY}} (ex _ {\ rm {D}}, em_ { \ rm {D}})}} \), где \ (I _ {\ rm {DY}} (ex _ {\ rm {D}}, em _ {\ rm {Y}}) \) - эмиссия в YO3- длина волны биотина после возбуждения DFHBI-1T, \ (I _ {\ rm {DY}} (ex _ {\ rm {Y}}, em _ {\ rm {Y}}) \) - это излучение на длине волны YO3-биотина после YO3- возбуждения биотина, а \ (I _ {\ rm {DY}} (ex _ {\ rm {D}}, em _ {\ rm {D}}) \) - это излучение на длине волны DFHBI-1T после возбуждения DFHBI-1T, все три с присутствием как DFHBI-1T, так и YO3-биотина.

Проточная цитометрия

Те же образцы, которые использовались для спектрофлуориметрических измерений (~ 50 мкл), разводили в 950 мкл соли 1 × M9 перед измерением на проточном цитометре Beckmann Coulter Gallios с лазером 488 нм и FL1 (575/30) и фильтры детектора FL3 (620/30).Для обработки данных использовалось программное обеспечение Kaluza Analysis. Эмиссию флуоресценции измеряли на 50 000 незащищенных клеток, содержащих как DFHBI-1T и YO3-биотин, так и только DFHBI-1T или YO3-биотин. Средние геометрические интенсивности закрытых клеток 2H-AE использовали в качестве фона и вычитали из средней геометрической интенсивности, измеренной на закрытых клетках, содержащих структуры apta-FRET. Интенсивность, возникающая из-за DFHBI-1T в канале FL3, была найдена с помощью \ (D _ {{\ rm {leak}}} = \ frac {{FL3 _ {\ rm {D}}}}} {{FL1 _ {\ rm {D} }}} \), где FL3 D и FL1 D - средние геометрические интенсивности в каналах FL3 и FL1, соответственно, из ячеек, содержащих только DFHBI-1T.\ ast FL1 _ {{\ rm {DY}}} + FL1 _ {{\ rm {DY}}}}} \), где \ (FL3 _ {{\ rm {DY}}} \) - выбросы YO3-биотина длина волны после возбуждения DFHBI-1T с присутствием как DFHBI-1T, так и YO3-биотина, \ (FL3 _ {\ rm {Y}} \) - это излучение на длине волны YO3-биотина после возбуждения DFHBI-1T с присутствием только YO3-биотина, и \ (FL1 _ {\ rm {DY}} \) - это излучение на длине волны DFHBI-1T после возбуждения DFHBI-1T с присутствием как DFHBI-1T, так и YO3-биотина.

Флуоресцентная микроскопия

Изображения флуоресцентной микроскопии получали с помощью Zeiss LSM 800 с масляным объективом 100X.Бактерии иммобилизовали на 96-луночных планшетах, покрытых поли-L-лизином (PLL) (µ-Plate, без покрытия, там же). 200 мкл PLL (10 мг / мл) вносили в лунки на 30 мин при 37 ° C, затем промывали свободной от нуклеаз H 2 O и сушили. В лунки добавляли 50 мкл культуры, приготовленной, как описано выше, в 1X солях M9, содержащих 100 мкМ DFHBI-1T и 17 мкМ YO3-биотина. DFHBI-1T возбуждали с использованием лазера 488 нм и регистрировали с использованием фильтра EGPF, а YO3-биотин возбуждали с помощью лазера 555 нм и регистрировали с использованием фильтра Texas Red.Сигнал FRET был получен путем возбуждения с использованием лазера 488 нм и записи с использованием техасского красного фильтра. Записанные изображения обрабатывались в MatLab (код доступен на нашей веб-странице www.andersen-lab.dk), где канал DFHBI-1T использовался для определения местоположения отдельных ячеек и определения их границ. Средняя интенсивность на пиксель в каждой ячейке была рассчитана для всех трех каналов. Клетки отбирали с использованием непосредственно возбуждаемой флуоресценции YO3-биотина и отбрасывали клетки с нижней 5% -ной интенсивностью, которая соответствует клеткам, не показывающим или показывающим очень низкую флуоресценцию YO3-биотина.Значения из каналов FRET и DFHBI-1T оставшихся ячеек использовались для вычисления относительных выходов FRET с использованием уравнения \ ({\ rm {FRET}} = \ frac {{{I _ {\ mathrm {DY}}} ( {ex _ {\ mathrm D}}, {em _ {\ mathrm Y}})}} {{{I _ {\ mathrm {DY}}} ({ex _ {\ mathrm D}}, {em _ {\ mathrm Y}}) )} + {{I _ {\ mathrm {DY}}} ({ex _ {\ mathrm D}}, {em _ {\ mathrm D}})}} \), где \ (I _ {\ mathrm {DY}} { ({ex _ {\ mathrm D}}, {em _ {\ mathrm Y}})} \) - это излучение на длине волны YO3-биотина (техасский красный фильтр) после возбуждения DFHBI-1T и \ (I _ {\ mathrm {DY} } {({ex _ {\ mathrm {D}}}, {em _ {\ mathrm D}})} \) - излучение на длине волны DFHBI-1T (фильтр EGFP) после возбуждения DFHBI-1T.Оба были измерены с присутствием DFHBI-1T и YO3-биотина. Тепловая карта FRET была создана путем вычисления относительного вывода FRET на пиксель в границах выбранных ячеек с использованием того же уравнения.

Доступность данных

Авторы заявляют, что основные данные, подтверждающие выводы этого исследования, доступны в статье и файле с дополнительной информацией к ней. Дополнительные данные можно получить у соответствующего автора по запросу.

Ноты гитарного грифа: как их понять

Ноты грифа гитары музыкально такие же, как и у любого другого западного инструмента.Фортепиано имеет 12 полутонов, как и гитара. Единственное исключение и реальное преимущество на гитаре - это изгиб струн для получения промежуточных звуков, что также возможно на клавиатуре с джойстиком или колесом. С музыкальной точки зрения, эти ноты сложно описать, и они используются в основном в блюзе и рок-музыке. По сути, вы можете согнуть гитарную струну на 1/4, и это звучит очень задушевно и блюзово в контексте следующей ноты. Все остальные тона - это всего лишь один из 12 полутонов.Гриф гитары иногда бывает трудно понять, потому что, в отличие от фортепиано, он не так четко расположен перед вами. У гитары есть узоры, и когда вы их видите, они становятся понятнее. Давайте немного распакуем гриф и посмотрим, сможете ли вы лучше разглядеть паттерны.

The Semitones - Ноты гитарного грифа

Примечания, которые у нас есть, находятся на расстоянии полшага друг от друга. Давайте посмотрим на октаву до, чтобы увидеть их:

1 2 3 4 5 6 7 8 9 10 11 12

C C # D D # E F F # G G # A A # B

От средней до до октавной ноты над ней, если вы играете и считаете каждую ноту, у вас будут 12 полутонов и все доступные вам музыкальные ноты.Вы можете сказать: «А я думал, это квартиры?» Да, конечно! Ради аргументации, давайте возьмем те же 12 полутонов, но на этот раз с использованием бемоля. Когда вы поймете диез и бемоль, вы поймете, что это одни и те же ноты, которые называются диезом или бемолью только в зависимости от тональности, в которой вы играете.

1 2 3 4 5 6 7 8 9 10 11 12

C Db D Eb E F Gb G Ab A Bb B

C # и Db - один и тот же тон, F # и Gb - один и тот же тон, G # и Ab - один и тот же тон, а A # и Bb - один и тот же тон.

The Key Signatures - Ноты гитарного грифа

Теперь мы можем идентифицировать 15 ключевых подписей, и D # и A # в них не включены. Пусть это вас не смущает. Вот 15 ключевых подписей, и это будут ноты, которые мы поможем вам связать с грифом гитары.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

C C # или (Db) D Eb E F F # или (Gb) G Ab A Bb B или (Cb)

Как видите, C # и Db - это один и тот же тон, но считаются двумя разными ключами.F # и Gb - это один и тот же тон, а B и Cb - одно и то же, но каждый из них имеет свою собственную подпись ключа. Всего 15 ключей. Из этих нот складываются все аккорды и мелодии, и происходит музыка.

Ноты с открытой строкой

Если гитара настроена на стандартную настройку, начиная с маленькой струны, это будет открытая E, открытая B, открытая G, открытая D, открытая A и открытая Big E. Отныне для обозначения заметки это будет просто «E0». O означает «открытый». Это первые шесть нот, которые вам нужно знать на грифе гитары.Убедитесь, что вы используете хороший тюнер, и, начиная с маленького E0, настройте свою гитару. Каждый тюнер индивидуален, но все они идентифицируют эти шесть нот. Когда стрелка вашего тюнера или лампа будут находиться в центре, вы найдете правильную высоту звука для каждой струны и будете готовы перейти на следующий уровень.

Первые или маленькие ноты E String

Начните с указательного пальца, поместите его на первую маленькую струну ми и ладайте на первой ладовой ноте. Эта нота находится в полушаге от вашего E0 и представляет собой F1.Теперь поместите 2-й палец на первую струну на 2-м ладу. Это примечание F # или Gb. Поместите 3-й палец на 1-ю струну, 3-й лад, и у вас есть G. Теперь мизинец на 4-м ладу, и у вас есть G # или Ab. Отлично, теперь переместите руку вперед, поместив 1-й палец на 5-й лад маленькой струны E. Пятый лад - это ля, 2-й палец, пожалуйста, на 6 ладу, и теперь у вас есть A # или Bb. 3-й палец на 7-м ладу - это B. Мизинец на 8-м ладу - это C.

Теперь снова проведите рукой.Переместите 1-й палец на 9-й лад струны E. Лад 9 - это C # или Db, лад 10 - это D, лад 11 - это D # или Eb, и, наконец, лад 12 - это E, которая представляет собой октаву от вашей маленькой струны E0, с которой вы начали. На 13-м ладу все повторяется до тех пор, пока на грифе не закончится свободное место. F13 - октава от F1.

Вторая строка или ноты B String

Следуя той же процедуре, что и выше, давайте сделаем ноты струны си. Начиная с первого пальца на 1-м ладу 2-й струны, это половина шага от B0 и называется C1.Перейдите на 2-й лад вторым пальцем, это C # или Db. Нота на 3-м ладу с использованием 3-го пальца - это D. Нота на 4-м ладу с использованием мизинца - это D # или Eb.

Теперь проведите рукой по грифу и положите первый палец на 5-й лад 2-й струны. Продолжайте выкладывать узор. Нота 5-го лада - это E, 6-й лад - это F, 7-й лад - это F # или Gb, а нота 8-го лада - это нота G. Снова проведите рукой. 1-й палец теперь на 9-м ладу, и эта нота - G # или Ab. 2-й палец на 10-м ладу, и у вас есть нота A.3-й палец на 11-м пальце для A # или Bb и, наконец, мизинец на 12-м ладу для B. Затем они повторяются на 13-м ладу. Здесь можно найти полезную диаграмму для всего этого.

Ноты третьей струны или G String

Давайте немного упростим это. Вы должны пробежать по схеме пальцев 1, 2, 3 и 4, затем скользить и повторить снова. Примечания к струне G следующие.

Начиная с лада 1. Лад 1 - это G2, лад 2 - это A, лад 3 - это A # или Bb, а лад 4 - это B.Слайд и лад 5 - это C, лад 6 - C # или Db, лад 7 - D, лад 8 - Eb. Сдвиньте снова, и лад 9 - это E, лад 10 - это F, лад 11 - это F # или Gb и, наконец, лад 12 - это G. Не так уж сложно, правда? Ноты гитарного грифа неплохи, если вы знаете, что делаете.

Четвертые ноты или ноты D-струны

Теперь двигаться быстрее. Вы должны начать двигаться вниз по грифу на каждой струне. Нота 1-го лада на струне D - это Eb. 2-й лад - это ми, 3-й лад - это фа, а мизинец на 4-м ладу - это фа #.Слайд и пятый лад - это G, лад 6 - это G # или Ab, лад 7 - это A, а лад 8 - это A # или Bb. Слайд и лад 9 - это си, лад 10 - это до, лад 11 - это C # или Db и, наконец, лад 12 на струне D - это D.

Пятые или строковые ноты

Веселье продолжается на струне A. Первая ладовая нота на струне A - это A # или Bb. Нота 2-го лада - это си, 3-й лад - до, а 4-й лад - это C # или Db. Слайд и пятый лад - это ре, шестой лад - это ре, или эб, седьмой лад - это ми, а восьмой лад - это фа.Слайд и нота на 9 ладу - это F #, нота на 10 ладу - это G, нота на 11 ладу - это G # или Ab и, наконец, нота на 12 ладу - это A. Еще одна струна, и у вас будут все ноты гитарного грифа. вниз.

Ноты шестой или большой струны E

Это очень просто, потому что она точно такая же, как маленькая струна ми ми. Первый палец на 1-м ладу - F, 2-й лад - F #, 3-й лад - G, а 4-й лад - G # или Ab. Slide и 5-й лад - это A, 6-й лад - это A # или Bb, 7-й лад - это B, а 8-й лад - это C.Слайд и 9-й лад - это C #, 10-й лад - это D, 11-й лад - это D # или Eb, и, наконец, нота 12-го лада - это E. Это относится к нотам гитарного грифа.

Не торопитесь и выучите каждую струну правильно. Запомните ноты на грифе гитары от открытой струны до 12-го лада и помните, что гриф повторяется после этого на 13-м ладу. Понимание нот на грифе гитары - это секрет того, как стать великим гитаристом. Действуй!

Выучив ноты на грифе гитары, вы станете на один шаг ближе к раскрытию своих творческих способностей и способностей к написанию песен.Еще один ресурс, который можно добавить к вашему обучению, - это онлайн-уроки игры на гитаре. Инструкторы по игре на гитаре в Pro Lessons будут рады стать вашим источником знаний о гитаре. Узнайте, как воспользоваться нашими доступными тарифами, нажав ниже.

MMP-10 (человек) Набор для обнаружения LANCE Ultra TR-FRET, 500 точек анализа

проверить количество ложный

Только для исследовательских целей; не для диагностических процедур.Все продукты должны использоваться в соответствии с применимыми законами и правилами, включая, помимо прочего, требования к потреблению и утилизации в соответствии с европейскими правилами REACH (EC 1907/2006).

Запросить дополнительную информацию купить сейчас Добавить в корзину Сделать запрос

Пожалуйста, введите действительное количество

Пожалуйста, авторизуйтесь, чтобы добавить в избранное.

НУЛЕВАЯ ИЛИ ПУСТАЯ КОРЗИНА

Обзор

Набор для обнаружения человеческого MMP-10 LANCE Ultra разработан для обнаружения и количественного определения человеческого фибриногена в забуференном растворе и средах для культивирования клеток с использованием гомогенного анализа TR-FRET (этапы без промывки и разделения).

Характеристики:

  • Этапы без промывки, без разделения
  • Технология TR-FRET
  • Чувствительное обнаружение
  • Высокая воспроизводимость
  • Более быстрое получение результата
  • Простая автоматизация
  • 96-, 384- и 1536-луночные форматы

LANCE и LANCE (возбуждает хелат лантаноидов) Ultra - это наши гомогенные (без промывки) технологии TR-FRET (резонансный перенос энергии флуоресценции с временным разрешением).Одно представляющее интерес антитело метят донорным флуорофором (хелат LANCE Europium), а вторую молекулу метят акцепторным флуорофором (краситель U Light ™). При возбуждении на длине волны 320 или 340 нм энергия может передаваться от донорного хелата европия к акцепторному флуорофору, если он достаточно близок для FRET (~ 10 нм). Это приводит к испусканию света с длиной волны 665 нм.

Матричная металлопротеиназа 10 (MMP10) также известна как стромелизин-2 или трансин-2. ММП участвуют в разрушении внеклеточного матрикса в нормальных физиологических процессах.MMP10 секретируется в форме «proMMP10» и расщепляется другими внеклеточными протеиназами, чтобы стать активным. MMP10 был связан с жизнеспособностью раковых стволовых клеток и метастазированием и был обозначен как потенциальный маркер рака полости рта.

Характеристики
Цель анализа MMP10
Целевой класс анализа Белок
Совместимость с автоматизацией Есть
Метод обнаружения Флуоресценция с временным разрешением (TRF), TR-FRET
Фирменное наименование продукта LANCE Ультра
Состояние при доставке Синий лед
Лечебный участок Рак
Размер блока 500 точек анализа
более Ресурсы, события и многое другое
Краткое описание приложения
Восемь ограничений ELISA и способы их преодоления с помощью альтернативных технологий

Введение иммуноферментных анализов (ELISA) в начале 1970-х годов дало исследователям платформу для нерадиометрических иммуноанализов без снижения чувствительности.За последние 50 лет ученые добились огромных успехов в исследованиях болезней и открытии лекарств, и возникла потребность в увеличении пропускной способности и чувствительности анализа. В ответ на это были разработаны более надежные иммуноанализы для устранения некоторых ограничений стандартного колориметрического ELISA.

Узнайте о наиболее распространенных ограничениях традиционных ИФА и о том, как различные альтернативные технологии ИФА устраняют эти ограничения.

PDF 1 МБ

Kling-On Fret Dots Неперманентный (статический винил) FDS-10

Модель: FDS-10
  • Низкие цены
  • Доставка по всему миру
  • Квалифицированный персонал
  • Гарантия соответствия
  • Полностью безопасный https

Описание

8 непостоянных (статический винил) и 2 полупостоянных (переставляемый световой клей) ладовые точки для вашей гитары.
1/8 "
3/8" (12 лад)

Характеристики

  • Модель: FDS-10
  • Изготовитель: Kling-On
  • Состояние: Новое
5.0 звездочный рейтинг 3 отзыва

Название и текст отзыва не могут быть пустыми Тело вопроса не может быть пустым Пожалуйста, введите рейтинг этого обзора Поле имени не может быть пустым Неверный адрес электронной почты Ваш отзыв уже отправлен. Превышена максимальная длина Пожалуйста, заполните все обязательные (*) поля Один или несколько ваших ответов не соответствуют требуемым критериям

Мы ценим ваш вклад.Поделитесь своим обзором, чтобы всем остальным он тоже понравился.

Ваш отзыв был успешно отправлен и теперь ожидает, когда наши сотрудники опубликуют его.

* Обозначает обязательное поле


Заголовок и текст отзыва не могут быть пустыми Тело вопроса не может быть пустым Пожалуйста, введите рейтинг этого обзора Поле имени не может быть пустым Неверный адрес электронной почты Ваш отзыв уже отправлен. Превышена максимальная длина Пожалуйста, заполните все обязательные (*) поля Один или несколько ваших ответов не соответствуют требуемым критериям

Пожалуйста, нажмите на ссылку в электронном письме с подтверждением, которое мы только что отправили вам, чтобы задать свой вопрос.
/> Ваш вопрос появится на сайте, как только кто-нибудь на него ответит.

  • Отзывы (3)

  • Вопросы (0)

Задайте вопрос первым

  1. Дом
  2. Аксессуары для гитары
  3. Инструменты практики | Ладные точки
  4. Kling-On Fret Dots Неперманентный (статический винил) FDS-10
.

Автор: alexxlab

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *