Дпкв симптомы неисправности: Неисправность датчика положения коленвала (ДПКВ). Как определить

Содержание

Неисправность датчика положения коленвала (ДПКВ). Как определить

Неисправности датчика коленвала обычно приводят к падению мощности двигателя, перерасходу топлива, снижению динамических характеристик автомобиля, появление детонации. При полном выходе ДПКВ из строя двигатель вовсе не будет работать, так как этот элемент синхронизирует работу систем зажигания и впрыска. Поэтому, сначала рассмотрим признаки и причины его неисправности, способы проверки и потом, в конце статьи, как обмануть датчик коленчатого вала и запустить двигатель, если авто не заводится, а ехать надо.

Содержание:

Расположение датчика положения коленчатого вала

Несмотря на то, что в разных машинах датчик положения коленчатого вала выполняет одну и ту же функцию, его расположение будет разниться в зависимости не только от марки и модели автомобиля, но и от установленного в нем двигателя. Рассмотрим несколько примеров.

На инжекторных двигателях «10-й серии», установленных на популярные отечественные автомобили ВАЗ-2110, 2111, 2112 датчик положения коленвала расположен в районе шкива ремня генератора, а именно на крышке масляного насоса.

На автомобилях Daewoo Nexia расположение датчика зависит от установленного в машине мотора. Так, на двигателе F16MF ДПКВ расположен напротив задающего венца (или другое название — диска), то есть, на заднем конце непосредственно коленчатого вала. На двигателях A15MF, G15MF и A15SMS той же машины датчик установлен напротив задающего диска на шкиве коленчатого вала.

На популярных машинах Renault Logan с двигателями объемом 1,4 и 1,6 литров чтобы добраться до датчика положения коленчатого вала необходимо будет демонтировать шланг воздухозаборника с патрубка воздушного фильтра. Так как ДПКВ находится справа внизу, в районе блока цилиндров. Непосредственно датчик можно легко опознать по крепежной пластине, имеющей два монтажных отверстия.

На автомобиле Hyundai Sonata датчик положения коленчатого вала находится под крышкой ремня ГРМ, внизу, в районе балансировочного ролика. Датчик можно найти по фишке, которая идет от него непосредственно к корпусу клапанной крышки.

Вообще, на большинстве автомобилей ДПКВ находится в непосредственной близости к коленчатому валу и/или к блоку цилиндров, на одном или другом его крае.

Отличительная черта датчика положения коленвала — наличие длинного провода, соединяющегося с фишкой питания прямо на нем. Если вы по каким-либо причинам не смогли найти датчик на собственном автомобиле — обратитесь за помощью к мануалу (технической документации) или поищите соответствующую информацию на тематических форумах в интернете.

Работа датчика положения коленвала

Функция датчика положения коленчатого вала — это синхронизация работы систем впрыска и зажигания. Он передает информацию о положении (угле поворота) коленвала в конкретный момент времени на электронный блок управления двигателем (ЭБУ), который, в свою очередь дает команды на зажигание топливной смеси в двигателе. Соответственно, при выходе датчика из строя двигатель попросту перестанет работать, то есть, заглохнет или не запуститься. Однако в большинстве случаев неисправность датчика положения коленвала выражается в отрыве или нестабильности провода питания и сигнала.

Принцип работы

Работа датчика ДПКВ, независимо от типа по котором работает заключается в том, чтобы отслеживать отсутствующий зубец на венце коленвала (или два зубца, в зависимости от конструкции конкретного двигателя).

Для этого существует так называемый синхронизирующий диск, по периметру которого расположены указанные металлические зубцы. Соответственно, датчик фиксирует их по магнитному полю. Однако он также “чувствует” пропуск двух из них, соответственно, в нем не образуется электрический сигнал. Происходит пропуск, что и является сигналом для ЭБУ о положении коленчатого вала в определенном положении и синхронизации системы зажигания по цилиндрам.

Так, если это магнитно-индукционный датчик, то он работает в магнитном поле (намагниченный сердечник с обмоткой из медной проволоки) и когда мимо него проходят металлические зубья диска синхронизации в нем появляется электрический ток (сигнал), который и передается на ЭБУ, сигнализируя об определенном положении коленчатого вала (соответствует положению пропущенных зубьев).

Датчики работают на так называемом эффекте Холла, который заключается в том, что возникает сигнал при пересечении переменным магнитным полем диска синхронизации, то есть, постоянного поля датчика положения коленчатого вала.

При этом изменяется его напряжение, которое и является сигналом, передаваемым на электронный блок управления.

Реже на автомобилях можно встретить так называемые оптические датчики. Они работают по принципу источника и приемника света через зубья синхронизирующего диска. Соответственно, в случае, если светопринимающий элемент отмечает, что свет пропал на большее, чем положено, время, то это становится сигналом для электронного блока управления об определенном положении коленвала с теми же последствиями, что и для датчиков других типов.

Кроме того ДПКВ не только фиксируют положение коленвала в конкретный момент времени, но и определяют частоту его вращения.

Признаки неисправности датчика коленвала

Есть типовые симптомы, как проявляется неисправность датчика коленвала:

  • снижение мощности двигателя, он «не тянет», в том числе при езде в гору и/или при загруженной машине;
  • обороты двигателя «плавают», причем во всех режимах, автомобиль дергается как во время движения, так и на холостом ходу;
  • возрастает расход топлива
    ;
  • «провал» при нажатии на педаль газа, машина не набирает обороты;
  • детонации двигателя на высоких оборотах работы двигателя;
  • появилась ошибка код P0336, что свидетельствует о нарушении диапазона / производительности датчика положения коленчатого вала.

Тут стоит сделать ремарку, и упомянуть о том, что перечисленные выше признаки неисправности датчика ДПКВ являются самыми частыми, и могут также указывать на поломку некоторых других автомобильных датчиков, диагностику которых тоже, возможно, придется сделать. Тем более, что датчик коленвала — достаточно надежная деталь и выходит из строя достаточно редко.

Причины неисправности датчика коленвала

Существует ряд типовых неисправностей, из-за которых датчик положения коленчатого вала перестает корректно работать. Среди основных поломок:

  • Нарушено расстояние между диском синхронизации и сердечником датчика. Обычно соответствующее значение находится в пределах от 0,5 до 1,5 миллиметра. Регулируется оно при помощи установленных регулировочных шайб. Расстояние может быть нарушено при замене датчика на новый, механическое смещение шайбы или датчика в результате ремонтных работ либо аварии. Также причиной подобной поломки может быть попадание грязи или пыли в зазор между датчиком и диском синхронизации.
  • Обрыв провода или плохой контакт. Например, у датчика может быть плохо соединена фишка питания, в результате повреждения ее фиксатора. Реже повреждается изоляция провода (снижение значения изоляции, перелом провода), из-за чего электрический сигнал проходит не на ЭБУ, а на корпус машины или другие элементы подкапотного пространства.
  • Повреждение обмотки. В редких случаях внутри датчика повреждается его обмотка, из-за чего он начинает некорректно работать либо не работать вовсе. Причины, по которым обмотка вышла из строя, могут быть различными — разрушение вследствие вибрации, окисления, некачественного (тонкого) провода, повреждение сердечника и так далее.
  • Повреждение диска синхронизации
    . Например, какие-либо зубья диска могут быть повреждены в результате выполнения ремонтных работ либо аварии. Если диск постоянно грязный, то зубья по естественным причинам могут изнашиваться и стачиваться. На тех авто, где стоит резиновый демпфер, в случае его разрыва, уходит метка отслеживания.
  • Повреждение светодиода либо элемента светопоглощения. Этот вариант подходит для старых машин, на двигателе которых установлен оптический датчик положения коленчатого вала.

Обычно при частичном или полном выходе датчика из строя его ремонт невозможен, поскольку его корпус является запаянным и неразборным. Соответственно, заменить провод (обмотку) и/или намагниченный сердечник в нем практически невозможно. По этой причине негодный датчик утилизируют, а вместо него покупают и устанавливают новый, благо цена на него невысокая, а в магазинах представлены самые различные модели для разных автомобилей.

Как определить неисправность датчика коленвала

Существует простой способ, как узнать неисправность датчика и сделать это можно любому с помощью буквально одного мультиметра. На большинстве современных автомобилей устанавливаются именно индукционные датчики положения коленвала, поэтому вкратце остановимся на проверке устройств этого типа.

Так, ДПКВ можно проверить тремя способами — с помощью омметра, проверить значение индуктивности катушки, а также с использованием осциллографа. Кроме этого, важным элементом проверки, какие признаки неисправности датчика коленвала появились, является выставление правильного зазора между чувствительным элементом датчика, а также диском синхронизации (расстояние нужно уточнить в документации, оно находится в пределах 0,5…1,5 мм).

Как проверить датчик коленвала?

Есть три способа проверки ДПКВ - мультиметром (проверяется сопротивление обмотки), тестером (проверяется сопротивления изоляции и индуктивности) и осциллографом.

Подробнее

 

Самый простой и доступный практически любому автовладельцу метод — проверить внутреннее сопротивление датчика. Для этого достаточно использовать электронный мультиметр, переключенный в режим измерения сопротивления электрической цепи. У большинства современных датчиков значение электрического сопротивления внутренней катушки составляет порядка 500…700 Ом (в некоторых случаях это значение может отличаться, поэтому желательно ознакомиться с техническими параметрами датчика отдельно). Также желательно проверить значение изоляции проводов. Оно не должно быть менее, чем 0,5 МОм.

Для измерения индуктивности автовладельцу понадобится мультиметр (мегаомметр), сетевой трансформатор, измеритель индуктивности, а также вольтметр. Опуская алгоритм проверки, стоит сразу отметить, что значение индуктивности внутренней катушки исправного датчика должно находиться в пределах около 200…400 мГн (может отличаться у разных датчиков, но незначительно). Если индуктивность значительно ниже (реже выше), то датчик, скорее всего неисправен, и необходимо выполнение дополнительных проверок, в том числе замер сопротивления катушки и изоляции.

Самый сложный, однако самый информативный и надежный метод проверки датчика положения коленчатого вала — с помощью осциллографа, обычно электронного (программный эмулятор). Для этого осциллограф подключают к выводам датчика при работающем двигателе автомобиля и настраивают программу для снятия осциллограммы. Ее рисунок даст четкое понимание, в рабочем ли состоянии датчик, и нет ли пробелов при его работе. Кроме этого, можно демонтировать датчик с его посадочного места, подключить к нему осциллограф и попросту поводить возле его чувствительного элемента каким-нибудь металлическим предметом (например, отверткой). Если он будет фиксировать передвижение, и на экране будет формироваться осциллограмма — скорее всего, датчик исправен.

В процессе проверки не будет лишним сканирование ошибок из памяти ЭБУ при помощи специальных сканеров. Это поможет как в определении ошибки ДПКВ, так и других элементов двигателя.

Как обмануть датчик и завести машину

На примере Ваз 2110 рассмотрим эффективный способ, как можно завести мотор при неработающем датчике коленвала.

Для этого нужно на корпус датчика намотать тонкую медную проволоку, сделать своеобразную обмотку. Проволоку можно взять из любого реле. Вокруг корпуса необходимо сделать 150 мотков, а остаток отвести к фишке, которая подключается к ДПКВ и всунуть концы в разъем вместо датчика коленвала.

Наматывание медной проволоки на корпус датчика

Фиксация проводов на фишке

Перед тем, как наматывать медную проволоку, вокруг корпуса датчика можно сделать 2 витка бумагой или тонким картоном.

Проволока наматывается сверху на бумагу, а потом убирается, таким образом самодельная обмотка нормально станет на корпус.

Если двигатель не запустится, то нужно будет поменять местами проводки подведенные к контактам фишки. Чтобы эти проводки не выпали, их следует временно зафиксировать спичками. Долго с такой конструкцией не стоит ездить, в последствии, вышедший из строя ДПКВ нужно обязательно заменить!

На всю работу уйдет не более 5 минут и одного метра проволоки.

Суть предложенного способа заключается в частичном восстановлении процесса электромагнитной индукции. То есть при поломке штатной катушки (залитой в корпус) таким образом можно сделать элементарную катушку, которая сможет функционировать совместно с центрирующим шкивом коленвала. Как результат, сигнал будет доходить до ЭБУ и двигатель заведется. Подробнее смотрите на видео ниже.

Как завести машину при неисправном ДПКВ

Спрашивайте в комментариях. Ответим обязательно!

Датчик коленвала: признаки неисправности

Коленчатый вал двигателя внутреннего сгорания – элемент КШМ, который служит для преобразования возвратно-поступательного движения поршней во вращательное. На инжекторных автомобилях с ЭСУД используется так называемый датчик положения коленчатого вала (ДПКВ, датчик синхронизации, датчик коленвала, датчик ВМТ, иногда в быту называется датчик фаз), который необходим для точной синхронизации работы системы зажигания и системы питания.

Как известно, система электронного управления двигателем имеет большое количество различных элементов. Если возникает неисправность какого-либо звена, ЭБУ переводит мотор в аварийный режим, двигатель может троить, плохо заводиться, на приборной панели загорается «чек» и т. д. При этом агрегат все равно будет работать, пусть и неустойчиво, если в него подается воздух, топливо и есть искра на свечах зажигания. Особенностью ДПКВ можно считать то, что неисправности или сбои в его работе обычно приводят к остановке двигателя. Далее мы рассмотрим, какие признаки неисправности датчика коленвала свидетельствуют о проблемах с указанным элементом.

Содержание статьи

Функции датчика коленчатого вала

Как уже было сказано, одним из явных признаков неполадок ДПКВ является полная остановка двигателя. Так получается в результате того, что сбои в его работе не позволяют системе питания своевременно подавать горючее, а система зажигания не способна в заданный момент поджечь топливно-воздушную смесь. Теперь рассмотрим, почему так происходит.

Датчик коленвала посылает сигналы в ЭБУ, сигнализируя о положении коленчатого вала в определенный момент, а также сообщает о направлении вращения вала и указывает частоту вращения. Отметим, что на разных автомобилях как само устройство, так и некоторые функции ДПКВ могут отличаться. Это зависит от типа установленного элемента. Устройства могут быть:

Электронный блок управления получает сигналы от указанного устройства, благодаря чему контроллер «знает» положение коленчатого вала по отношению к ВМТ в первом и четвертом цилиндре, а также фиксирует частоту и направление вращения вала.  На основе этих данных блок формирует сигналы для управления моментом зажигания, создает управляющие импульсы для инжекторных форсунок, управляет работой топливного насоса и т.д.

Датчик положения коленвала: признаки неисправности и проверка ДПКВ

В том случае, если причиной неполадок является датчик коленвала, признаки неисправности могут быть следующими:

  • холодный или прогретый двигатель не заводится;
  • во время работы под нагрузкой возникает детонация;
  • плавают обороты холостого хода;
  • снижается мощность двигателя, пропадает динамика;
  • скачут обороты во время движения, произвольно меняются обороты и т.д.

Необходимо учитывать, что указанные симптомы могут появляться и в результате других неисправностей. По этой причине перед началом манипуляций с ДПКВ следует исключить другие возможные неполадки. Еще следует добавить, что сбои в работе датчика коленвала могут возникать не постоянно. Другими словами, неустойчивая работа ДВС или проблемы с запуском могут проявляться не всегда, хотя «чек» загорается. В этакой ситуации рекомендуется произвести компьютерную диагностику двигателя автомобиля для более точного определения причины.

Рекомендуем также прочитать статью о том, что показывает компьютерная диагностика двигателя. Из этой статьи вы узнаете о том, как проводится указанная диагностика, что дает проверка и сканирование ошибок, а также как самому выполнить компьютерную диагностику автомобиля.

Также можно проверить датчик положения коленвала самостоятельно. Для такой проверки существует несколько доступных способов, которые позволяют с относительной точностью определить работоспособность элемента. Устройство заключено в пластиковый корпус, который обычно крепится на кронштейне в месте расположения шкива привода генератора.   Также к элементу может быть подключен провод, который имеет большую длину. Использование такого провода обусловлено тем, что место установки ДПКВ является достаточно удаленным.

Отметим, что сам по себе датчик коленчатого вала выходит из строя редко. Чаще причиной является механическое повреждение во время осуществления работ в подкапотном пространстве, а также попадание посторонних предметов в пространство между датчиком и зубчатым шкивом.

Если визуальный осмотр ничего не выявил, тогда датчик синхронизации понадобится снять, после чего можно переходить к проверке. Элемент следует осмотреть повторно, что помогает определить повреждения корпуса, сердечника, контактной колодки. Следует добавить, что достаточно часто после простой очистки контактов и сердечников от грязи ДПКВ начинает нормально работать.

В том случае, когда видимых дефектов не было замечено, следует перейти к диагностике датчика при помощи мультиметра. Устройство переводят в режим омметра для замера сопротивления на обмотке ДПКВ. В норме показания должны составлять 550-750 Ом. Также существует способ, при помощи которого фиксируется индуктивность датчика синхронизации, но такая диагностика сложнее для реализации в гаражных условиях и требует дополнительного оборудования (вольтметр, сетевой трансформатор).

Следует отметить, что одним из быстрых способов проверки является установка заведомо исправного или нового датчика синхронизации. Если двигатель заводится и нормально работает после замены, тогда причина очевидна. Еще нужно учитывать, что во время установки датчика коленчатого вала следует правильно выставлять зазор, который присутствует между зубчатым шкивом и ДПКВ. Квалифицированная установка датчика предполагает то, что зазор между сердечником датчика и диском синхронизации составляет 0.5 – 1.5 мм. Регулировка указанного зазора возможна путем установки дополнительных шайб в месте расположения посадочного гнезда датчика коленчатого вала.

Подведем итог

С учетом вышесказанного можно сделать вывод о том, что датчик коленвала является одним из самых важных элементов в общей схеме электронного управления силовым агрегатом. Выход из строя ДПКВ приведет к полной остановке двигателя, сбои в его работе сильно осложняют эксплуатацию ТС или делают езду на автомобиле практически невозможной.

По этой причине рекомендуется иметь запасной датчик коленвала в автомобилях, на которых владельцы регулярно преодолевают значительные расстояния по трассе. Также нужно добавить, что стоимость датчика коленвала для большинства отечественных и иностранных авто является вполне доступной.

Что касается проверки и замены, в самом начале следует убедиться, что в зазоре между датчиком и диском синхронизации нет посторонних предметов, а также сам зазор находится в допустимых рамках. Параллельно следует учитывать и то, что устройство может быть исправным и работоспособным, а причиной сбоев является грязь на сердечнике ДПКВ.

Читайте также

Признаки неисправного датчика положения коленвала (ДПКВ)

Существует ряд причин, по которым датчик положения коленчатого вала может выйти из строя, и ряд симптомов, связанных с этим отказом. Проблемы с датчиком положения коленчатого вала часто проявляются как проблемы с синхронизацией двигателя. Вот несколько общих симптомов неисправного датчика коленчатого вала, которые могут помочь вам определить, вышел ли он из строя.
Проблемы с датчиком коленвала могут быть связаны с несколькими причинами. К 2 распространенным относятся:

1. Перегрев двигателя. Чрезмерное нагревание двигателя может привести к повреждению датчика из-за расплавления пластикового покрытия.
2. Проблемы проводки. Неправильное напряжение или ослабленная, изношенная или поврежденная проводка может нарушить передачу сигналов на ДПКВ и от него, что приведет к возникновению проблем.
Обычно неисправный датчик вызывает любой из следующих признаков, которые предупреждают водителя о потенциальной проблеме, которую необходимо устранить.


Проблемы с запуском автомобиля

Наиболее частый симптом и чаще распространённый - затруднение при запуске двигателя. Датчик коленвала контролирует положение и частоту вращения коленчатого вала, а также другие параметры, которые играют важную роль при запуске двигателя. Если датчик неисправен, возможно, у автомобиля периодически возникают проблемы с запуском или вообще не запустится, что более вероятно.
Неисправный датчик может повлиять на угол опережения зажигания вашего автомобиля. Это может привести к тому, что на свечи зажигания не будет подаваться напряжение, что приведет к невозможности запуска. Если затронут только один или два цилиндра, проблема может быть в катушке зажигания.

Периодическая остановка

Если датчик или его проводка имеют какие-либо проблемы, то это может привести к отключению сигнала коленчатого вала при работающем двигателе, что в следствии приведет к остановке двигателя.
Проблемы с датчиком усугубляются при низких оборотах двигателя. Иногда двигатель может даже полностью заглохнуть на низких оборотах, если топливные форсунки не подадут ему необходимое топливо.
Обычно это признак проблемы с проводкой. Однако неисправный датчик коленвала также может вызывать данную проблему.

Неравномерное ускорение транспортного средства

Из-за неточного входного сигнала, поступающего от датчика положения коленчатого вала, блок управления двигателем не может регулировать время зажигания и впрыск топлива при увеличении частоты вращения двигателя. Медленное или неравномерное ускорение может быть результатом недостаточной точности и затруднить поддержание постоянной скорости.

Пропуски зажигания или вибрация в двигателе

Если чувствуете вибрацию в двигателе, то это может быть признаком пропусков зажигания в цилиндрах из-за неисправного датчика положения коленчатого вала. Поэтому он не может предоставить правильную информацию о положении поршня в двигателе, что приводит к пропуску зажигания в цилиндре. Это также может происходить из-за неправильной синхронизации свечей зажигания.

Резкий холостой ход и вибрация двигателя

Еще один признак неисправности ДПКВ - грубый холостой ход. На холостом ходу на красный свет или при остановке иным образом вы можете заметить скрежет или вибрацию двигателя. Датчик не контролирует положение коленчатого вала, что приводит к вибрациям, которые влияют на общую мощность двигателя.

Увеличение потребления топлива

Не имея точной информации о времени от датчика положения коленчатого вала, топливные форсунки не могут эффективно подавать топливо в камеру сгорания. Двигатель будет использовать больше топлива, чем ему нужно, на коротких и длинных поездках, что снизит общую экономию топлива.

Загорается индикатор двигателя Check Engine

Если компьютер обнаружит проблему с сигналом датчика положения коленчатого вала, то он активирует световой индикатор Check Engine, чтобы предупредить водителя о проблеме. Индикатор Check Engine также может быть вызван рядом множеством других проблем. Настоятельно рекомендуется выполнить диагностику на наличие неисправностей.

ДПКВ имеет решающее значение для правильной работы и производительности двигателя из-за важного сигнала, который он обеспечивает для расчетов двигателя. Проблемы с датчиком могут быстро привести к проблемам, влияющих на управляемость автомобиля.

Датчик коленвала – признаки неисправности этого важного узла авто

ДПКВ является неотъемлемой частью любого транспортного средства. Неработоспособность этого элемента может пагубно отразиться на функционировании двигателя. Сейчас мы расскажем вам, что такое датчик положения коленчатого вала, как обнаружить его поломку и как его правильно протестировать.

Содержание

[ Раскрыть]

[ Скрыть]

Что такое ДПКВ?

ДПКВ — это электромагнитное устройство, определяющее синхронизацию функционирования топливных форсунок и системы впрыска. В системе впрыска топлива это устройство является одним из самых основных, поскольку без него работа системы в принципе невозможна.

Вышедший из строя ДПКВ

Поломки этого датчика со временем станут причиной появления сбоев в работе мотора. И хотя такие поломки не особо часто встречаются на практике, если вы решили отправиться в дальнюю дорогу, лучше иметь в запасе рабочее устройство. Ведь в случае его поломки езда на машине будет невозможной.

ДПКВ располагается около вала привода генератора при помощи специальных креплений. Он должен быть установлен с небольшим зазором между самим устройством и зубчатым валом. В идеале этот зазор не должен превышать 1 мм, а выставляет он при помощи подбора определенных шайб. Принцип работы регулятора заключается в том, чтобы передавать определенные показания, по которым контроллер будет определять, в какой конкретно цилиндр следует подавать горючую смесь и с каким интервалом.

Этот регулятор — индуктивного типа. ДПКВ реагирует на прохождение зубчиков вала.

Как выявить неисправности?

 Загрузка ...

Далее поговорим о признаках поломки. Каковы основные симптомы неисправности датчика коленвала? Такой вопрос является актуальным. Основными признаками выхода из строя регулятора положения коленчатого шкива можно назвать:

  1. Детонирование двигателя (стук гидрокомпенсаторов) при больших нагрузках или езде в гору на пониженных оборотах.
  2. Мотор стал работать менее устойчиво. В частности, на холостом ходу вы заметите падение и резкое увеличение оборотов. Кроме того, ваше транспортное средство может заглохнуть на холостом ходу как во время езды, так и при стопе на светофоре.
  3. Мотор не может работать на полную мощность, и это падение оборотов вы сможете заметить без приборных показаний. Мощность двигателя может периодически падать и подниматься, вне зависимости от каких-либо факторов.
  4. Значительное снижение динамических характеристик транспортного средства.
  5. С запуском двигателя внутреннего сгорания могут возникнуть проблемы.
  6. Кроме того, одним из самых заметных признаков поломки данного регулятора, как указано ранее, является невозможность запуска мотора.
  7. Еще один признак неисправности датчика положения коленчатого вала — пропадает искра, не совсем отсутствует, но периодически не появляется.

Разумеется, такие неисправности могут свидетельствовать и о других неполадках в работе мотора. К примеру, падение мощности и оборотов может говорить о засорении бензонасоса или поломке топливного фильтра. Но информация, приведенная ниже, поможет вам продиагностировать устройство.

Как проверить работоспособность?

Чтобы сделать это, можно воспользоваться несколькими способами. Всех их мы рассматривать не будет, а уделим время только двум, самым основным и наиболее точным способам. В любом случае, для выполнения диагностики вам необходимо демонтировать элемент, чтобы проверить его работоспособность. При демонтаже регулятора положения коленчатого шкива следует визуально осмотреть его — возможно, неисправности скажут сами за себя.

Зачастую визуальный осмотр дает возможность выявить определенные повреждения корпуса элемента, а также состояние самой колодки и непосредственно контактов. Если регулятор слишком грязный, его нужно промыть спиртом, поскольку его контакты всегда должны быть в чистоте. Если этот метод диагностики не помог обнаружить поломку, то следует проверить датчик более тщательно.

Первый способ

При помощи омметра можно произвести замер показателя сопротивления обмотки устройства синхронизации. Если регулятор вашего автомобиля находится в рабочем состоянии, то показатели омметра должны варьироваться в районе 550 — 750 ом.

Вольтметр для диагностики

Но перед тем, как приступить к диагностике регулятора положения шкива, уточните в мануале к вашей машине точный диапазон показателей для ДПКВ. Производитель указывает этот нюанс наиболее точно и вам нужно будет ориентироваться по нему. Если полученные результаты отличаются от тех, которые указаны в инструкции, то ДПКВ необходимо заменить, поскольку он является неисправным.

Второй способ

Этот метод позволит более точно определить состояние компонента. Чтобы протестировать устройство, вам потребуется:

  • цифровой вольтметр;
  • мегаомметр;
  • устройство для измерения индуктивности;
  • сетевой трансформатор.
Мегаомметр для диагностики прибора

Чтобы показатели были более точными, рекомендуется осуществлять диагностику при температуре воздуха не менее 20 и не более 22 градусов.

Сначала следует замерить показатель индуктивности обмотки регулятора. Для этого используйте измеритель индуктивности. Нормальные показания должны варьироваться в районе 200 — 400 мегагерц.

Используя мегаомметр, следует осуществить диагностику показателя изоляции. Если уровень напряжения составляет около 500 вольт, то показатель изоляции не должны превышать 20 мегаом.

Измеритель индуктивности для диагностики

Сетевой трансформатор потребуется в тех случаях, если в ходе диагностики устройства произойдет случайное намагничивание шкива синхронизации. Проанализировав полученные результаты, вы сможете сделать вывод о работоспособности ДПКВ или его выходе из строя. Как видите, такой способ проверки регулятора положения шкива требует определенных знаний.

Видео от Рамиля Абдуллина «Самостоятельная диагностика ДПКВ»

О том, как своими силами осуществить диагностику регулятора в домашних условиях, вы узнаете из видео.

как прозвонить устройство мультиметром и проверить тестером положение коленчатого вала

ДПКВ представляет собой устройство, предназначенное для синхронизации топливных форсунок, а также зажигания в системе впрыска горючего. Если сломался или выходит из строя датчик коленвала, признаки неисправности позволят определить поломку для своевременного ремонта и замены устройства.

Содержание

[ Раскрыть]

[ Скрыть]

Назначение, устройство и принцип действия

Датчик положения коленвала двигателя в автомобиле выполняет основную опцию регулировки системы впрыска горючего. Его наличие обеспечивает синхронную работу каждой форсунки мотора и системы зажигания в целом.

Контроллер состоит из следующих компонентов:

  • 1 — капроновый каркас устройства;
  • 2 — магнитные сердечники, эти элементы выполнены из стали;
  • 3 — комплект обмотки, для которой применяется утонченный медный кабель;
  • 4 — изоляционный слой электроцепи, обычно выполнен в виде эмали либо смолы.
Схематическое устройство ДПКВ

Нестабильное функционирование контроллера приведет к сбоям во времени при подаче горючего. При работе устройства управляющий модуль автомобиля, являющийся микроконтроллером, обеспечивает правильное положение поршня в конкретный промежуток времени для каждого цилиндра ДВС.

Чтобы обеспечить регулировку посредством устройства, процесс строится по такому алгоритму:

  1. Коленвал силового агрегата оснащается специальным зубчатым валом. На нем два зубца отсутствуют, это сделано специально.
  2. Когда коленвал мотора машины начинает двигаться, все зубья проходят в непосредственной близости с контроллером. Это способствует серьезному искажению его магнитного поля.
  3. При прохождении вала происходит формирование сигналов в индукционной катушке контроллера. Пакетные импульсы передаются в базу информации, которая содержится в памяти микроконтроллера. Два зубчика, которые отсутствуют на валу, считаются начальной, а также нулевой точкой. Посредством отсутствия этих зубьев микропроцессорное устройство выполняет диагностику изначального расположения коленвала.
  4. После этого микропроцессор внутри автомобиля выполняет подсчет числа сигналов, которые были отправлены устройством. Производится процедура определения положения коленчатого вала в определенный промежуток времени.
  5. Затем обработанные импульсные данные передаются управляющим блоком на контроллер, использующийся для активации топливной форсунки. Последняя выполняет подачу горючего в системе зажигания.

Если датчик положения коленвала работает корректно, то двигатель автомобиля будет функционировать с максимальной производительностью. На выделение максимальной мощности силовому агрегату потребуется минимум горючего.

Разновидности датчиков

Отдельно следует рассказать о различных типах устройств:

  1. Магнитные индукционные ДПКВ. Данный тип устройств не требует для питания отдельного аккумулятора. Для импульса управляющего модуля инициируется величина напряжения в конкретное время. Это происходит тогда, когда через магнитное поле проходит синхронизационный зубчик. Магнитное поле появляется вокруг контроллера, а само устройство контролирует обороты вала и может применяться в качестве скоростного контроллера.
  2. Контроллер Холла, его работа основана на эффекте Холла. Это свидетельствует о том, что передача тока начинается в момент, когда меняющееся поле подается на устройство. Синхронизационный вал выполняет перекрытие самого поля, посредством зубчиков взаимодействуя с полем, появившимся вокруг контроллера. Контроллер, работа которого основана на эффекте Холла, применяется в качестве распределительного устройства зажигания.
  3. Устройство оптического типа. Такая разновидность контроллеров включает в себя вал, выполняющий синхронизацию посредством отверстий либо зубчиков. Диск производит перекрытие светового потока, проходящего между диодным элементом и приемником. Последний выполняет переработку поступившего светового потока в сигнал. В результате напряжение подается на микропроцессорный модуль.

Где находится датчик коленвала?

Контроллер устанавливается в моторном отсеке на специальном кронштейне. Последний располагается в центральной части вала на приводном устройстве генераторной установки. На современных машинах ДПКВ обычно располагается не впритык, а с небольшим зазором рядом с зубчатым валом. Последний составляет 1-1,5 мм.

Расположение ДПКВ рядом с задающим валом

Основные признаки неисправности ДПКВ

Неисправный датчик либо неполадки в работе сенсора устройства можно определить по признакам:

  1. Силовой агрегат автомобиля стал детонировать. При работе мотора на холостых оборотах либо при увеличении скорости проявляется стук гидрокомпенсаторов. Так называемые пальчики могут стучать при езде в гору на низких оборотах ДВС.
  2. Мотор машины стал функционировать не так устойчиво, как ранее. Обороты силового агрегата могут резко упасть при движении на холостом ходу или измениться в большую сторону. Транспортное средство может заглохнуть при езде на холостых оборотах, стоя в пробке или на светофоре.
  3. Силовой агрегат не набирает нужное количество оборотов, хотя функционирует на максимальной мощности.
  4. Мощность двигателя машины может упасть, а затем увеличиться. При этом водитель не будет предпринимать каких-либо действий.
  5. Заметно падают аэродинамические свойства и характеристики машины.
  6. Появляются неполадки в пуске силового агрегата. Мотор может не запускаться либо заводиться и быстро глохнуть.
  7. При выполнении зажигания пропадает искра. Она может не появляться вовсе или возникать с определенной периодичностью.

Если автовладельцем было обнаружено не меньше трех «симптомов» неисправности ДПКВ, устройство подлежит замене.

Надо учесть, что описанные неполадки не всегда говорят о поломке контроллера. Они могут свидетельствовать и о других неисправностях в работе силового агрегата. К примеру, резкое изменение мощности ДВС и падение оборотов говорит о засорении топливного насоса либо магистралей, подведенных к нему. Признаки неисправности в работе ДПКВ могут возникнуть при загрязнении разъема подключения датчика.

Канал Govorun4eg Auto на практике показал признаки неполадок в работе ДПКВ.

Как проверить ДПКВ на работоспособность?

Проверка работы ДПКВ может быть выполнена тремя способами:

  • мультиметром либо другим аналогичным тестером;
  • посредством комплексной проверки;
  • с помощью осциллографа.

Диагностика датчика положения коленвала омметром

Используя омметр, можно прозвонить обмотку контроллера для замера величины сопротивления. При отсутствии омметра допускается применение мультиметров. В результате диагностики на рабочем датчике параметр сопротивления должен составить от 550 до 750 Ом.

Сам процесс прозвона заключается в замере величины сопротивления катушки в индуктивном контроллере. Если этот элемент устройства неработоспособен, то неисправность отразится на рабочем параметре сопротивления. Поэтому перед выполнением проверки надо выставить необходимый диапазон и произвести диагностику корректности функционирования устройства посредством щупов.

Метод проверки датчика коленвала с помощью омметра считается самым простым в плане реализации, но он не может дать 100-процентный результат.

Николай Ваганов продемонстрировал процедуру диагностики ДПКВ посредством мультиметра.

Комплексная диагностика датчика положения коленвала

Если обнаружены в работе датчика коленвала признаки неисправности, можно прибегнуть к методу комплексной проверки. Такой вариант диагностики является сложным в плане реализации, но более точным. Для его выполнения потребуется комплекс приборов и оборудования, имеющийся не на каждом СТО.

Для реализации задачи понадобится:

  • мегомметр;
  • сетевое трансформаторное устройство, будет применяться для расшифровки информации;
  • традиционный образец устройства для замера индуктивности;
  • мультиметр либо цифровой вольтметр.

При выполнении комплексной диагностики датчика коленвала рекомендуется поддерживать температурный режим в районе 20-22 градусов. Это условие требуется для обеспечения корректных значений, которые будет выдавать оборудование.

Особенности проведения комплексной диагностики устройства:

  1. Посредством омметра либо другого тестера выполняется диагностика рабочей величины сопротивления.
  2. Используя устройство для замера индуктивности, производится измерение величины индукции на обмотке контроллера. Если датчик работоспособен, то полученная величина должна составить в районе 250-400 мГн.
  3. Затем выполняется процедура измерения величины сопротивления на изоляционном слое. При подаче напряжения 500 вольт значение рабочего параметра должно быть около 20 мОм. Сетевое трансформаторное устройство потребуется в случае появления периодического намагничивания контроллера. Если устройство исправно, то все полученные в результате проверки значения будут находиться в установленных пределах.

Канал Автоэлектрика ВЧ показал еще один уникальный вариант диагностики контроллера — с использованием гаечного ключа.

Диагностика подачи сигнала датчиком положения коленвала с помощью осциллографа

Этот вариант диагностики является наиболее точным из всех описанных. Все потому, что выполняется проверка не только комплектующей запчасти для коленчатого вала, но и его конструкции при функционировании двигателя. Суть диагностики состоит в подключении осциллографа к контроллеру и мониторинга сигналов посредством пиктограмм, которые отходят от него. При выполнении проверки не нужно снимать датчик с силового агрегата, поскольку все действия будут выполняться на запущенном ДВС.

Алгоритм диагностики:

  1. Кабель с черным зажимом соединяется с массой или «землей» силового агрегата автомобиля.
  2. Затем производится монтаж пробника щупа к сигнальным контактам непосредственно контроллера. Подключение выполняется по параллели. Чтобы определить сигнальный выход, соответствующий разъем должен иметь маркировку с символом А.
  3. Следующим этапом будет подключение второго щупа диагностического оборудования. Разъем соединяется с аналоговым входом с компьютером или ноутбуком. На последнем должно быть заранее установлено и настроено программное обеспечение.
  4. При корректном соединении всех электроцепей на экране ПК появится сигнал от осциллографа. Он будет выполнен в виде графика. Напряжение импульса определяется на входе диагностирующегося контроллера.
  5. Для выполнения диагностики на оборудовании надо указать особый режим вывода графика. Этот режим именуется как Inductive Crankshaft. После установки всех параметров производится запуск силового агрегата. Затем выполняется мониторинг всех параметров от контроллера.

При получении импульса от контроллера, не соответствующего номинальным параметрам, силовой агрегат будет заметно подергиваться. При запуске мотора могут проявляться трудности.

Появление таких дефектов при мониторинге выходных импульсов у контроллера сообщит о следующих неполадках:

  • неисправности в работе конструкции контроллера;
  • неполадки в работе элемента, предназначенного для работы с синхронизирующим валом;
  • неисправности в зубчиках.

Точно определить, какой из компонентов неработоспособен, получится после полной диагностики типа изменения импульсных волн. Обычно замене подлежит не сам контроллер, а зубчатый диск — со временем он изнашивается и приходит в негодность.

Канал Диагностика автомобилей рассказал об особенностях проверки ДПКВ с использованием карманного осциллографа.

Как заменить ДПКВ?

Чтобы обеспечить более удобный демонтаж и процедуру регулировки или замены контроллера, к нему подключается кабель длиной 50-70 см. Этот провод оснащается специальными разъемами для гаечных ключей. С целью осуществления настройки положения контроллера потребуется регулировка шайбы, зафиксированной над посадочным местом устройства. Процедура корректировки этой шайбы осуществляется в гаражных условиях либо на СТО. Правильная регулировка даст возможность избежать быстрого выхода из строя цилиндров силового агрегата и понизить расход горючего.

Алгоритм действия при замене контроллера:

  1. Обесточивается контроллер, для этого надо отключить разъем с проводкой от устройства.
  2. С использованием торцевого гаечного ключа выполняется откручивание винта, фиксирующего устройство к посадочному месту.
  3. Сам контроллер демонтируется.
  4. Производится монтаж исправного контроллера в место посадки. Винт, фиксирующий устройство, закручивается обратно. Производится подключение разъема с проводами.
  5. После установки контроллера надо произвести контрольную диагностику измерения величины люфта. Проверяется зазор между зубчиками шкива приводного устройства генераторной установки, а также сердечником контроллера. Для измерения параметра используется комплект щупов. Величина люфта должна быть от 0,39 до 0,41 мм, в идеале — 1 мм.

Если диагностика показала, что зазор значительно отклонен от необходимой величины, то производится регулировка положения контроллера. Либо надо избавиться от имеющихся загрязнений. После проведения замены выполняется пуск ДВС и диагностика правильности выполненных работ.

Видео «Пример замены ДПКВ на автомобиле ВАЗ»

Канал В гараже у Сандро рассказал об особенностях замены контроллера в автомобилях ВАЗ десятого семейства, а также Калине, Гранте и Приоре.

Признаки неисправности датчика распредвала - блог kitaec.ua

Для чего нужен датчик распредвала

Функционированием силового агрегата в современных автомобилях управляет электроника. ЭБУ (электронный блок управления) вырабатывает управляющие импульсы на основе анализа сигналов, поступающих с многочисленных датчиков. Сенсоры, размещенные в различных местах, дают возможность ЭБУ оценить состояние двигателя в каждый конкретный момент времени и оперативно скорректировать те или иные параметры.

В числе таких сенсоров — датчик положения распредвала (ДПРВ). Его сигнал позволяет синхронизировать работу системы впрыскивания горючей смеси в цилиндры двигателя.

В подавляющем большинстве инжекторных двигателей применяется распределенное последовательное (фазированное) впрыскивание смеси. При этом ЭБУ поочередно открывает каждую форсунку, обеспечивая поступление воздушно-топливной смеси в цилиндры перед самым тактом впуска. Фазирование, то есть правильную последовательность и нужный момент открывания форсунок, как раз и обеспечивает ДПРВ, отчего его нередко называют датчиком фазы.

Нормальная работа системы впрыска позволяет добиться оптимального сжигания горючей смеси, повысить мощность мотора и избежать лишнего расхода топлива.

Устройство и разновидности датчиков положения распредвала

В автомобилях можно встретить датчики фазы трех типов:

  • основанные на эффекте Холла;
  • индукционные;
  • оптические.

Американский физик Эдвин Холл в 1879 году обнаружил, что если подключенный к источнику постоянного тока проводник поместить в магнитное поле, то в этом проводнике возникает поперечная разность потенциалов.

ДПРВ, в котором используется данное явление, обычно так и называют — датчик Холла. В корпусе устройства размещены постоянный магнит, магнитопровод и микросхема с чувствительным элементом. К устройству подводится напряжение питания (обычно 12 В от аккумулятора или 5 В от отдельного стабилизатора). С выхода расположенного в микросхеме операционного усилителя снимается сигнал, который подается на ЭБУ.

Конструктивное исполнение датчика Холла может быть щелевым


и торцевым


В первом случае зубцы реперного диска распредвала проходят через щель датчика, во втором — перед торцом.

Пока силовые линии магнитного поля не перекрываются металлом зубьев, на чувствительном элементе имеется некоторое напряжение, а на выходе ДПРВ сигнал отсутствует. Но в тот момент, когда репер пересекает силовые линии магнитного поля, напряжение на чувствительном элементе исчезает, а на выходе устройства сигнал возрастает практически до величины напряжения питания.

С приборами щелевой конструкции обычно используется задающий диск, имеющий воздушный зазор. Когда этот зазор проходит через магнитное поле датчика, формируется управляющий импульс.

Совместно с торцевым устройством, как правило, применяется зубчатый диск.

Реперный диск и датчик фазы установлены таким образом, что управляющий импульс на ЭБУ подается в момент прохождения верхней мертвой точки (ВМТ) поршнем 1-го цилиндра, то есть в начале нового цикла работы агрегата. В дизельных моторах формирование импульсов обычно происходит для каждого цилиндра в отдельности.

В качестве ДПРВ чаще всего используется именно датчик Холла. Однако нередко можно встретить и сенсор индукционного типа, в котором также имеется постоянный магнит, а поверх намагниченного сердечника намотана катушка индуктивности. Изменяющееся при прохождении реперов магнитное поле создает в катушке электрические импульсы.

В устройствах оптического типа используется оптопара, а управляющие импульсы формируются, когда оптическая связь между светодиодом и фотодиодом прерывается при прохождении реперов. Оптические ДПРВ пока что не нашли широкого применения в автомобилестроении, хотя их можно встретить в некоторых моделях.

Какие симптомы говорят о неисправности ДПРВ

Оптимальный режим подачи воздушно-топливной смеси в цилиндры датчик фазы обеспечивает совместно с датчиком положения коленвала (ДПКВ). Если датчик фазы перестает работать, блок управления переводит силовой агрегат в аварийный режим, когда впрыскивание осуществляется попарно-параллельно на основе сигнала ДПКВ. При этом открываются по две форсунки одновременно, одна на такте впуска, другая на такте выпуска. При таком режиме работы агрегата заметно увеличивается потребление топлива. Поэтому перерасход горючего — один из главных признаков неисправности датчика распредвала.

Кроме повысившейся прожорливости двигателя о проблемах с ДПРВ могут говорить и другие симптомы:

  • неустойчивая, с перебоями, работа мотора;
  • затрудненный запуск двигателя, независимо от степени его прогрева;
  • повышенный нагрев мотора, о чем свидетельствует рост температуры охлаждающей жидкости по сравнению с нормальным режимом работы;
  • на приборной панели светится индикатор CHECK ENGINE, а бортовой компьютер выдает соответствующий код ошибки.

Почему ДПРВ выходит из строя и как его проверить

Датчик положения распредвала может не работать по нескольким причинам.

  1. Первым делом осмотрите устройство и убедитесь в отсутствии механических повреждений.
  2. Некорректные показания ДПРВ могут быть вызваны слишком большим зазором между торцом датчика и задающим диском. Поэтому проверьте, плотно ли датчик сидит в своем посадочном месте и не болтается ли из-за плохо затянутого болта крепления.
  3. Сняв предварительно клемму с минуса батареи, разъедините разъем датчика и посмотрите, нет ли в нем грязи или воды, не окислены ли контакты. Проверьте целостность проводов. Иногда они перегнивают в месте пайки к контактам разъема, поэтому для проверки слегка подергайте их.
    Подсоединив аккумулятор и включив зажигание, убедитесь в том, что напряжение на фишке между крайними контактами присутствует. Наличие электропитания необходимо для датчика Холла (с трехконтактной фишкой), если же ДПРВ индукционного типа (двухконтактная фишка), то питание ему не требуется.
  4. Внутри самого устройства возможно замыкание или обрыв, в датчике Холла может сгореть микросхема. Такое бывает из-за перегрева или нестабильного электропитания.
  5. Датчик фазы может не работать также из-за повреждения задающего (реперного) диска.

Чтобы проверить работоспособность ДПРВ, извлеките его из посадочного места. На датчик Холла должно подаваться питание (фишка вставлена, АКБ подсоединена, зажигание включено). Вам понадобится мультиметр в режиме измерения постоянного напряжения на пределе примерно 30 Вольт. Еще лучше воспользоваться осциллографом.

Щупы измерительного прибора с острыми наконечниками (иглами) вставьте в разъем, подсоединив их к контакту 1 (общий провод) и контакту 2 (сигнальный провод). Измерительный прибор должен зафиксировать напряжение питания. Поднесите к торцу или щели устройства металлический предмет, например гаечный ключ. Напряжение должно упасть почти до нуля.

Аналогичным способом можно проверить и индукционный датчик, только изменения напряжения у него будут несколько иными. ДПРВ индукционного типа не требует питания, поэтому для проверки его можно полностью снять.

Если датчик никак не реагирует на приближение металлического предмета, значит он неисправен и его необходимо заменить. Для ремонта он не годится.

В разных моделях автомобилей могут использоваться ДПРВ разного типа и конструкции, кроме того они могут быть рассчитаны на разное напряжение питание. Чтобы не ошибиться, приобретайте новый датчик с такой же маркировкой, как и на заменяемом устройстве.


признаки неисправности, принцип работы, ошибки

ДПКВ

Датчик положения коленчатого вала  (ДПКВ)  также называют датчиком синхронизации, поскольку контролёр за счёт него синхронизирует свою работу с работой двигателя.

Как работает ДПКВ?

Принцип работы датчика заключается в формировании сигналов по принципу индукции: в момент, когда шкив коленчатого вала проходит своими зубьями около сердечника ДПКВ, создаются импульсы переменного тока. Иными словами, по вращению шкива, датчик считывает зубья, и ЭБУ (контроллёр) контролирует работу двигателя (контролирует работу форсунок и системы зажигания). Поэтому, если датчик будет неисправен, запустить двигатель у вас не получится.

Местонахождение датчик положения коленвала

Где находится  ДПКВ?

Датчик положения коленчатого вала находится в подкапотном пространстве, рядом с распределительным валом, около шкива привода генератора (обратите внимание на рисунок).

Признаки неисправности ДПКВ

К признакам неисправности датчика положения коленчатого вала можно отнести следующие симптомы:

  1. Нестабильная работа двигателя на холостом ходу.
  2. Глохнет на холостом ходу ( нет холостого хода), (стоит отметить, что данные признаки неисправности имеют датчики: РХХ, ДПДЗ; советуем обратить на это внимание).
  3. Двигатель глохнет.
  4. Двигатель не заводится.
  5. Падение мощности двигателя.
  6. Возникает детонация при нагрузке на двигатель.
  7. Пропуск искры.

О том, как устранить неисправность ДПКВ, читайте статью: Как устранить неисправности ДПКВ?  Как проверить и заменить ДПКВ?

Цена на ДПКВ

Цена на Датчик положения коленчатого вала составляет примерно 250-350р. в зависимости от региона. Купить датчик можно в любом магазине автозапчастей.

Номер ДПКВ

Номер датчика коленчатого вала по каталогу: 2112-3847010-04. Данный датчик устанавливается на двигатли ВАЗ. Так же возможна замена данного датчика на: DR6123, DR6130.

Ошибки ДПКВ

Прочитать ошибки ДПКВ можно как с помощью диагностики, так и с помощью бортового компьютера. Так же, при наличии ошибки ДПКВ на приборной панели будет гореть лампа “CHECK ENGINE”.

Ошибка 0335 – не верный сигнал ДПКВ.

Ошибка 0336 – Ошибка сигнала датчика положения коленчатого вала.

Датчики впрыска автомобиля ВАЗ

Рис.10. Регулятор давления топлива

Регулятор давления топлива (РДТ) ВАЗ

RDT - клапан, регулирующий давление в топливной рампе. По принципу работы идет не датчик, а контроллер.Поскольку он не связан с ЭБУ, его неисправность не отображается на панели приборов. При неисправности РДТ могут возникнуть проблемы с запуском двигателя, увеличивается содержание СО в выхлопных газах, увеличивается расход газа, рывки, потеря мощности.

РДТ на ваз установлен на топливную рампу. RDT соединяет одну трубу с баком, а другую с впускным коллектором.

Test RTD позволяет измерить давление топлива в рампе. Давление должно быть на холостом ходу, сняв вакуумную трубку с RDT 2.84-3,25 бар, а сборка 2,2-2,4 бар.

Регулятор давления топлива также может располагаться в баке вместе с топливным насосом и поддерживать давление 3,8 бар.

Рис.9. МАК

Регулятор холостого хода (РХВ) для ВАЗ

Датчик представляет собой шаговый двигатель, который по команде блока управления двигателем изменяет сечение воздушного канала в обход дроссельной заслонки. Регулятор холостого хода (IAC) размещен на дроссельной заслонке (и TPS). Датчик обеспечивает стабильность холостого хода.

При выходе из строя датчика нестабильные обороты двигателя на холостом ходу, глохнет при запуске, при небольшом нажатии на педаль газа работает нормально.

Датчик довольно часто выходит из строя. Часто страдает от загрязнения.

Если есть неисправность РХХ, то нужно снять датчик, промыть шток датчика и воздушный канал от грязи. Часто помогает промывание.

Рис.8. Лямбда-зонд

Лямбда-зонд или датчик концентрации кислорода

Контролирует количество кислорода в выхлопных газах.Активно участвует в регулировании смесеобразования в двигателе. У Евро 2 1 лямбда, у Евро-3 две (вторая только управляет микшированием). При пробеге более 80 тысяч километров может выйти из строя или засориться. Начинает давать неверные показания. Появляется расход топлива, ухудшение динамики двигателя.

Рис.7. Датчик массового расхода воздуха

Датчик массового расхода воздуха (MAF) ВАЗ

Датчик представляет собой термоанемометр. Датчик расположен сразу за воздушным фильтром и контролирует количество забираемого снаружи воздуха.Предназначен для управления потоком воздуха. Иногда выходит из строя. При незначительных неисправностях блок управления ECU, как правило, не показывает ошибку, а указывает, когда датчик полностью вышел из строя.

Признаками неисправного MAF являются:

плавающий холостой ход, повышенный расход топлива, проблемы с запуском двигателя, ухудшение неровности тяги двигателя.

Датчик можно проверить следующим образом:

1. Проверить расход воздуха на холостом ходу и при 3000 об / мин. Расход должен составлять 8-10 и 28-32 кг / час.

2. Поставить рабочий датчик и кататься.

3. Измерьте напряжение на датчике. При выключенном двигателе напряжение должно быть 0,996 В.

Рис.6. Датчик скорости

Датчик скорости (левый) ВАЗ

Датчик установлен на коробке передач (трансмиссии). DS генерирует импульсы в зависимости от скорости автомобиля. На ВАЗах использовалось всего шесть импульсных датчиков скорости. Датчик тоже влияет на смесеобразование, его здоровье немаловажно.

Рис.5. Датчик температуры охлаждающей жидкости

Датчик температуры охлаждающей жидкости (CTS) ВАЗ

Датчик контролирует температуру охлаждающей жидкости (охлаждающей жидкости), передает информацию в блок управления (ЭБУ). ЭБУ включает-выключает вентилятор радиатора, влияет на работу клапана адсорбера, регулирует обороты на холодном двигателе.

Датчик устанавливается между термостатом и головкой блока цилиндров. Это обычный термистор.

Типовые значения электрического сопротивления датчика охлаждающей жидкости при 100 градусах составляют 177 Ом и 25 грамм.2796 Ом, 0 гр. 9420 Ом 20 гр. 28680 Ом.

Датчик выходит из строя редко. Общая неисправность обрыв линии связи между датчиком и ЭБУ. В случае отказа датчика ЭБУ работает в аварийном режиме и принимает температуру двигателя равной 0С, что затрудняет запуск двигателя в холодную погоду. Если я запускаю двигатель, то через несколько минут ЭБУ считает, что двигатель прогрет до 80С.

Рис.4. Датчик детонации

Датчик детонации (КС) ВАЗ

DD устанавливается на блоке цилиндров между третьим и вторым цилиндрами.Принцип работы резонансный и широкополосный. Эти датчики не взаимозаменяемы.

Датчик детонации контролирует двигатель и, в зависимости от величины детонации, помогает блоку управления (ЭБУ) регулировать угол опережения зажигания (угол опережения).

Если датчик неисправен, двигатель будет работать хаотично, увеличивается расход бензина.

Рис.3. Датчик положения распределительного вала

Датчик положения распределительного вала (ДПРВ). Фазы датчика

DPLL определяет угловое положение распределительного вала.Способствовал работе в нужное время нужной форсунки конкретного цилиндра (поэтапный впрыск).

Неисправность датчика приводит к перерасходу бензина, т.к. поток топлива находится в попарно-параллельном режиме.

Датчик расположен в торцевой части головки блока цилиндров рядом с воздушным фильтром на 8-клапанных двигателях и на головке блока цилиндров в районе 16-клапанных двигателей 1-го цилиндра.

Рис.2. Датчик положения дроссельной заслонки

Датчик положения дроссельной заслонки (ДПС) ВАЗ

Датчик расположен на корпусе дроссельной заслонки.Почти переменное сопротивление. По показаниям датчика электронный блок управления двигателем (ЭБУ) рассчитывает продолжительность впрыска топлива и опережения зажигания.

Датчик связан с РХХ, определяет степень открытия дроссельной заслонки. В случае отказа датчика работа двигателя на низких оборотах становится неустойчивой или даже глохнет двигатель. Лампа может загореться Check Engine.

При обрыве цепи датчика двигатель начинает работать в аварийном режиме с частотой вращения холостого хода около 1500.

Рис.1. Датчик положения коленвала

Датчик положения коленчатого вала CKP sensor (ДПКВ) ВАЗ

Датчик изображения показан на рис.1. Датчик (датчик CKP) контролирует вращение коленчатого вала, генерирует сигналы в электронный блок управления (ECU), которые обрабатываются, и ECU отправляет импульс на форсунки. Для этого на коленчатом валу устанавливается зубчатый диск. Датчик находится на крышке масляного насоса. Без датчика CKP запустить двигатель практически невозможно.Датчик редко чистится, но запасной все же полезно носить с собой.

Датчики впрыска автомобиля ВАЗ

Современные автомобили, оснащенные системами впрыска топлива, повышающими мощность двигателя, экономичность. Использование таких систем требует использования различных датчиков для автоматизации вождения.

Вот краткий обзор концепции и назначения основных датчиков в современных автомобилях с впрыском топлива.

Преобразователи, датчики, датчики - Информационный портал 2011 → Использование материала возможно при размещении активной ссылки

Расположение датчика

Многим владельцам будет полезно узнать, каковы симптомы неисправности датчика коленвала ВАЗ 2110.Некоторые из них, особенно те, кто впервые сталкивается с инжекторными двигателями, даже не подозревают о его существовании. Тем не менее, он доступен и выполняет важную функцию в управлении двигателем. Современные моторы оснащены несколькими разными датчиками, но этот - «главный». Его выход из строя делает невозможным запуск силового агрегата.

Владельцы этого семейства автомобилей должны знать симптомы неисправности датчика коленвала ВАЗ 2110, чтобы иметь возможность ориентироваться в ситуации, когда возникают проблемы с силовым агрегатом автомобиля.Двигатели могут комплектоваться устройствами разной конструкции, поэтому для их замены в случае необходимости нужно искать аналог устройства, используемого на вашей машине.

Зачем он нужен на машине?

При возникновении проблем с запуском силового агрегата большинство водителей сразу же начинают искать проблемы в топливной системе или в блоке зажигания автомобиля. Но такие поиски не всегда приводят к успеху и двигатель заводится. После обращения к специалистам выясняется, что виноват датчик положения коленвала.На первый взгляд такая маленькая деталь, но сколько проблем возникло из-за нее.

Это устройство предназначено не для выполнения функций управления, а для синхронизации фаз впрыска топлива и подачи сигнала на его зажигание в камере сгорания цилиндра двигателя. Исходя из этого, можно с уверенностью утверждать, что сбой в работе этого устройства приведет к несогласованности этих систем, запуск и работа мотора будет невозможна.


Устройство индукционного типа, которое должно реагировать на прохождение зубьев на мастер-диске.Он установлен на шкиве привода генератора, а сам датчик расположен рядом со шкивом. На диске 60 зубцов, два из которых вырезаны, образуя углубление. Благодаря его наличию осуществляется синхронизация с ВМТ поршней двигателя. Когда долина проходит мимо устройства, на блок управления трансмиссией выдается импульс сигнала.

Существуют конструкции таких продуктов, которые основаны на эффекте Холла, где продукт также реагирует на вращающийся диск, но срабатывание происходит при прохождении постоянного магнита, после чего изменяется сопротивление датчика и выдается управляющий импульс.На модель ВАЗ 2110 устанавливаются изделия индукционного типа. Место его установки нельзя назвать удобным для замены, поэтому к устройству прилагается кабель с разъемом, его длина примерно 80 см.

Немного о симптомах неисправностей В случае полного сбоя в работоспособности данного устройства не удастся запустить блок питания «десятки» даже при очень сильном желании. Только его полная замена позволит дальнейшее движение вашего автомобиля.Ситуации, когда этот датчик внезапно выходит из строя, крайне редки, обычно проблемы начинают накапливаться постепенно. Водители начинают замечать самое важное во время вождения.

При резком нажатии на педаль газа появляется такое неприятное явление, как «поломка». В карбюраторных двигателях такое случается, когда некачественно работает ускорительный насос, а в данной модели его нет, ДПКВ со своими функциями не справляется. Бывают моменты, когда оно появляется. Некоторые начинающие водители грешат на качество залитого топлива и продолжают ездить, но это не так и может привести к серьезным поломкам силового агрегата.

Также необходимо обратить внимание на данное устройство в том случае, когда по непонятным причинам расход топлива двигателем вашего автомобиля стал заметно выше. Проблемы с этим устройством также могут стать причиной нестабильной работы мотора во всех режимах. Внезапный отказ этого анализатора в основном связан с заводским браком при изготовлении продукта, и так часто виноват «человеческий» фактор. Наличие разного рода загрязнений в зоне его установки, плохой электрический контакт в разъеме, полностью нарушают работу всех систем двигателя.

Что делать?

Спешить сразу не надо, выбросьте такой прибор, сначала нужно его проверить. Вы можете сделать это самостоятельно в своем гараже, имея в своем распоряжении мультиметр. Причиной проверки может быть свечение сигнальной лампы «ПРОВЕРИТЬ ДВИГАТЕЛЬ», специалисты переводят эти слова, как проверить двигатель. Ошибки в виде кода 19 или 35 будут обнаружены в блоке управления. Суть проверки этого прибора заключается в измерении сопротивления его рабочей обмотки.В исправном датчике значение должно быть в пределах 800 - 900 Ом.

Как видите, ничего особенного в этой системе нет. Мы разобрались с признаками неисправности датчика коленвала ВАЗ 2110, теперь твердо можем сказать, что вы будете «во всеоружии», когда возникнет такая ситуация. «Опытные» десятки владельцев рекомендуют постоянно возить его в машине. Стоит недорого, но может выручить в самый неподходящий момент.

Ни для кого не секрет, что управление двигателем на «десятой» модели отечественного автопроизводителя АвтоВАЗ осуществляется компьютером.Различные датчики принимают данные, отправляют их на главный компьютер, который распределяет работу систем.

Примечательно, что только этот элемент может оставить двигатель работать при выходе из строя регулятора. Назначение этого датчика - синхронизировать систему зажигания и систему подачи топлива.

Если устройство выходит из строя, синхронизация нарушается. Следовательно, вся система выходит из строя. Искры нет, топливо не подается. Двигатель может какое-то время вести себя странно, но потом все равно глохнет.

Как он работает

Посмотрим, как работает этот элемент. Регулятор считывает данные о частоте вращения коленчатого вала, а также сообщает о его текущем положении с помощью магнитных импульсов.

Поскольку двигатели, устанавливаемые на ВАЗ 2110, отличаются друг от друга, также используются различные датчики ПКВ. Поэтому при замене обязательно выбирайте аналогичный прибор, так как регулятор с другими характеристиками банально работать не будет, поэтому система все равно не будет работать даже при наличии качественного исправного датчика.

Признаки неисправности

Если в вашем распоряжении есть мультиметр и обычная отвертка, вы без проблем сможете самостоятельно проверить работу прибора.

Признаки неисправности датчика коленвала включают:

  • На панели приборов загорается сигнальная лампа, рекомендующая проверить двигатель;
  • На холостом ходу двигатель ведет себя нестабильно;
  • Тяговые капли;
  • Обороты двигателя падают, повышаются;
  • Детонация происходит, то есть выстрелы из впускного или выпускного коллектора;
  • Двигатель не запускается.

Экзамен

Перед тем, как его проверить, сначала нужно добраться до него. Причем устройство расположено в не очень удобном месте на двигателе. Так что будьте готовы потратить на это немного времени.

Вообще искомый датчик находится на крышке масляного насоса. Искать его нужно прямо возле шкива генератора.

Теперь к вопросу, как это проверить. Давайте рассмотрим две наиболее распространенные ситуации, но сначала давайте удалим элемент.

  • Датчик демонтируется ключом на 10 мм;
  • Обязательно сделайте специальные отметки на картере и датчике перед снятием. Это позволит вернуть его на исходное место или установить новый регулятор в правильное положение;
  • Если нет внешних видимых повреждений датчика коленвала, то необходимо использовать мультиметр;
  • Не забудьте измерить расстояние между датчиком и диском синхронизации. В нормальном положении зазор составляет 0.6 и 1,5 миллиметра.

Первый способ проверки

В этом случае вам понадобится омметр , которым вы замените сопротивление на обмотке. По нормам завода-производителя показатель составляет от 550 до 750 Ом.

Ничего страшного, если ваши показатели немного отличаются от нормы. Если отклонения серьезные, датчик обязательно придется заменить.

Справедливости ради стоит отметить, что датчик положения коленвала на моделях ВАЗ 2110 выходит из строя редко.Среди основных причин отказа от нормальной функциональности - скопление грязи, механические повреждения, а также банальный заводской брак.

Метод второй

Здесь вам понадобятся вольтметр, трансформатор и измеритель индуктивности. Сопротивление желательно измерять в условиях компактной температуры.

Когда будут получены показания омметра, вооружитесь измерителем индуктивности. V Обычно прибор должен показывать от 200 до 4000 единиц (миллигенри).

Мегаомметр измеряет сопротивление, когда на обмотку датчика положения коленчатого вала подается напряжение 500 вольт. В нормальных условиях показания будут не более 20 МОм.

Нюансы замены

Заменить датчик достаточно просто. Его удаляют из среды обитания, а на его место устанавливают новое устройство.

Однако важно учесть некоторые нюансы.

  1. Выбирайте автозапчасти высокого качества, которые стоит приобретать в специализированных магазинах.Желательно проверить их работоспособность на месте.
  2. При повторной установке нового регулятора сохраните исходное положение. Чтобы запомнить это, нанесите маркером или мелом соответствующие отметки.
  3. Не забудьте соблюдать необходимое расстояние между датчиком и синхронизирующим диском. Мы уже сообщали вам о нормальном индикаторе разрыва.
  4. Болты необходимо затягивать с моментом затяжки не более 8-12 нм.
  5. Проверьте новый датчик перед его использованием в топливной системе.Неправильно подобранное устройство может привести к ряду других неисправностей, выходу из строя силового агрегата.

Самостоятельно проверить и поменять датчик положения коленвала на отечественную «десятку». Самый проблемный этап работы - получение доступа к устройству, так как оно спрятано достаточно далеко. Однако если вы справитесь с этим, все последующие действия покажутся вам пустяком.

4 года назад

Благодаря датчику положения коленчатого вала осуществляется синхронная работа системы зажигания и системы подачи топлива в двигатель автомобиля.Проще говоря, контроллер, который управляет системой полного впрыска, определяет, когда форсунки получают команду подавать топливо в цилиндры, а также устанавливает момент подачи искры в соответствующий цилиндр - и все это благодаря одному датчику.

Примечание!
Вам понадобится минимальный набор инструментов: гаечный ключ на «10», а лучше ручка и соединительная головка, мультиметр для проверки работоспособности датчика.

Расположение датчика

Сам датчик закреплен на кронштейне, находящемся на крышке масляного насоса, лицевой стороной смотрит на зубья большого шкива коленчатого вала (обозначено синей стрелкой).В задней части датчика находятся клеммы, к которым подключается колодка проводки, идущая от контроллера (обозначена красной стрелкой на фото).

Когда менять датчик?

Со временем забивается, потому что находится внизу, а грязь появляется на его лицевой стороне. Снимите его с автомобиля и аккуратно очистите переднюю часть датчика от грязи щеткой. Если не помогает, замените датчик на новый. В противном случае мощность значительно упадет и при разгоне будет детонация (подробности здесь: «»).Однако не стоит менять датчик, не проверив его, потому что аналогичные симптомы относятся и к другим датчикам (например, сбит ГРМ, клавиши плохо закреплены на месте, не справляется натяжной ролик).

Замена этого датчика на ВАЗ 2110-ВАЗ 2112

1. Датчик - электронная составляющая двигателя, к нему подключены провода, поэтому перед началом работ обесточьте бортовую сеть автомобиля: снимите минусовую клемму с АКБ (порядок действий описан в статья: «Замена АКБ в авто»).

2. Теперь отожмите рукой защелку, фиксирующую проводку к датчику, и отсоедините ее (фото 1). Соблюдайте осторожность, на практике достаточно случаев поломки защелки из-за чрезмерного обнажения. Затем с помощью гаечного ключа откручиваем болт, благодаря которому датчик крепится к кронштейну (фото 2), и снимаем датчик. На приборе включите функцию вольтметра с пределом измерения до 200 мВ и подключите идущие от него провода к клеммам датчика (фото 4).С помощью отвертки с плоским лезвием очень быстро попытайтесь провести ее по поверхности датчика. Прибор начнет давать показания в районе 0,3 В. Ничего не происходит? - заменить датчик.

Примечание!
Правильнее проверять датчик на исправность, когда он установлен на станке. К клеммам датчика подключается специальное устройство. прибор, заведите машину и наблюдайте за прыжками на приборе. Учтите, что машина не заводится, не перегружайте аккумулятор.

3. Если окажется, что датчик нуждается в замене, обязательно берите точно такой же: идентичной формы и длины. После установки проверьте с помощью набора специальных щупов расстояние между лицевой стороной датчика и зубьями шкива коленчатого вала, это расстояние должно быть в пределах 1 ± 0,41 мм.

Дополнительное видео:
Ниже представлены видеоролики по теме сегодняшней статьи, рекомендуем ознакомиться.

Значение датчика коленвала ВАЗ-2110 для двигателя сложно переоценить.Именно с его помощью отслеживается частота вращения двигателя. Стабильная работа возможна только при нормальном функционировании данного устройства и системы управления. Многие датчики отправляют сигналы в центральный блок, который обрабатывает данные и с помощью исполнительных механизмов регулирует момент зажигания и подачу смеси в камеры сгорания. Но если произойдет поломка, двигатель перестанет нормально работать - пропадет искра, топливо в камеры сгорания не поступит.И запустить двигатель ни в горячем, ни в холодном виде будет невозможно.

Принцип работы датчика коленвала

С датчика, установленного напротив коленчатого вала, сигнал поступает на электронный блок управления. Но есть одна особенность - на шкиве 58 зубьев. И есть небольшой зазор - он равен расстоянию между двумя зубцами. Именно с этим зазором датчик распознает положение.

Это выглядит так:

  1. При вращении коленчатого вала датчик считывает количество зубцов - должно быть ровно 58 импульсов с равным зазором между соседними.
  2. Все эти данные передаются по проводу датчика коленвала ВАЗ-2110 на электронный блок управления.
  3. Затем датчик попадает в зазор без зубцов на шкиве, и ЭБУ контролирует это состояние.
  4. С помощью щели без зубцов считывается количество оборотов мотора.
  5. Благодаря наличию зубцов, расположенных на равном расстоянии друг от друга, электронный блок микроконтроллера понимает, в каком положении находится коленчатый вал.

Если вам нужно заменить устройство, обязательно установите такое же, как и раньше. В противном случае может нарушиться работа мотора или вообще не получится его запустить.

Как определить поломку?

Для проверки работоспособности устройства вам понадобятся только отвертка и мультиметр.

К основным симптомам поломки ДПКВ относятся:

  1. Нестабильная работа двигателя на холостом ходу, полная остановка.
  2. Пониженная мощность и тяга.
  3. Число оборотов коленвала постоянно скачет.
  4. Возможна детонация - слышны выстрелы во впускном и выпускном коллекторах.
  5. Запуск двигателя затруднен или невозможен.
  6. Приборка двигателя.

Если есть один из симптомов, то это прямо указывает на необходимость замены датчика коленвала ВАЗ-2110.

Как снять устройство?

Датчик расположен на стороне привода генератора, напротив шкива коленчатого вала.Вы можете найти его, посмотрев на заднюю часть двигателя, на масляный насос. Перед снятием устройства сделайте отметки - это позволит установить новое в правильное положение. Следовательно, после ремонта двигатель не выйдет из строя.

Для демонтажа понадобится ключ на 10. Порядок работ следующий:

  1. Отсоедините колодку с проводами, которые соединяли устройство с системой управления двигателем.
  2. Сделав отметки, открутите гайку от корпуса датчика.
  3. Снимите устройство для проверки или замены.

Но может датчик исправен, значит надо его проверить. Перед снятием ДПКВ измерьте расстояние от его края до шкива - оно должно быть в пределах 0,6-1,5 мм. Если больше максимального значения, то отрегулируйте и попробуйте запустить мотор.

Диагностика омметром

Самое первое, что можно сделать, это измерить сопротивление обмотки датчика. По принятым производителем нормам нормальным является значение 550-750 Ом.Вполне допустимо, если оно отличается на 50-100 Ом от этих значений. Но если сопротивление слишком велико или отсутствует (обрыв), обязательно замените датчик коленвала ВАЗ-2110. Но поломка случается крайне редко - гораздо чаще на его активной части скапливается грязь и пыль, либо корпус подвергается механическим воздействиям. Старайтесь часто чистить устройство и не подвергать его ударам.

Особенности замены

Теперь вы знаете коленчатый вал ВАЗ-2110, и если он сломан, вам необходимо его заменить.

Обратите внимание на несколько нюансов, которые необходимо учитывать:

  1. Старайтесь приобретать качественные товары, рекомендованные производителем.
  2. Обязательно пометьте для облегчения замены устройства.
  3. Расстояние от края зуба до рабочей поверхности датчика коленвала ВАЗ-2110 должно быть в допустимых пределах.
  4. Момент затяжки для резьбовых соединений 8-12 Н * м.
  5. Измерьте сопротивление перед установкой нового датчика.

Своевременная очистка активной поверхности прибора обеспечит его нормальную работу на долгое время. Однако нельзя использовать жесткие методы - используйте мягкую тряпку или старую зубную щетку (наиболее подходящий инструмент для этой работы). Недопустимо использование металлических щеток или наждачной бумаги. Чтобы лучше удалить грязь с поверхности, нанесите небольшое количество WD-40. Затем протрите ДПКВ насухо и попробуйте запустить двигатель.

Как известно, электронная система управления двигателем имеет большое количество различных элементов.При выходе из строя какого-либо звена переводит двигатель в аварийный режим, двигатель может утроиться, плохо заводиться, на приборной панели и т.д. это искра от свечей зажигания, подаваемых на него. Особенностью ДПКВ можно считать то, что неисправности или сбои в его работе обычно приводят к остановке двигателя. Далее рассмотрим, какие признаки неисправности датчика коленвала указывают на проблемы с указанным элементом.

Читайте в этой статье

Функции датчика коленчатого вала

Как уже было сказано, одним из явных признаков неисправности ДПКВ является полная остановка двигателя. Это связано с тем, что сбои в его работе не позволяют системе питания своевременно подавать топливо, а система зажигания не способна воспламенить топливно-воздушную смесь в данный момент. Теперь посмотрим, почему это происходит.

Датчик коленчатого вала отправляет сигналы в ЭБУ, сигнализируя положение коленчатого вала в определенный момент, а также сообщает направление вращения вала и указывает скорость.Учтите, что на разных автомобилях как само устройство, так и некоторые функции ДПКВ могут отличаться. Это зависит от типа установленного элемента. Устройств может быть:

  • магнитно-индуктивного типа;
  • датчиков оптических;

Электронный блок управления принимает сигналы от указанного устройства, благодаря которым контроллер «знает» положение коленчатого вала по отношению к ВМТ в первом и четвертом цилиндрах, а также фиксирует частоту и направление вращения вала.На основе этих данных блок формирует сигналы для управления моментом зажигания, генерирует управляющие импульсы для инжекторов впрыска, управляет работой и т. Д.

Датчик положения коленвала: признаки неисправности и проверка ДПКВ

В случае, если причиной неисправности является датчик коленвала, симптомы неисправности могут быть следующими:

  • холодный или горячий двигатель не запускается;
  • возникает при работе под нагрузкой;
  • Мощность двигателя
  • уменьшается, пропадает динамика;
  • Скачок
  • об / мин во время движения, произвольное изменение об / мин и т. Д.

Следует учитывать, что данные симптомы могут появиться в результате других неисправностей. По этой причине перед началом манипуляций с ДПКВ следует исключить другие возможные неисправности. Также следует добавить, что неисправности датчика коленвала могут возникать не постоянно. Другими словами, нестабильная работа ДВС или проблемы с запуском могут появиться не всегда, хотя «галочка» горит. В такой ситуации рекомендуется произвести компьютерную диагностику двигателя автомобиля для более точного определения причины.

Так же вы можете проверить датчик положения коленвала самостоятельно. Для такой проверки существует несколько доступных методов, позволяющих определить исправность элемента с относительной точностью. Устройство заключено в пластиковый корпус, который обычно крепится на кронштейне в месте расположения шкива привода генератора. Также к элементу можно подключить длинный провод. Использование такого провода связано с тем, что место установки ДПКВ достаточно удаленное.

Учтите, что сам датчик коленвала выходит из строя редко.Чаще всего причиной являются механические повреждения при работе в моторном отсеке, а также попадание посторонних предметов в пространство между датчиком и зубчатым шкивом.

Если визуальный осмотр ничего не выявил, то датчик синхронизации нужно будет снять, после чего можно переходить к проверке. Необходимо повторно осмотреть элемент, чтобы выявить повреждение корпуса, сердечника, клеммной колодки. Следует добавить, что довольно часто после простой очистки контактов и жил от грязи ДПКВ начинает нормально работать.

В случае, если видимых дефектов не обнаружено, приступить к диагностике датчика с помощью мультиметра. Прибор переводят в режим омметра для измерения сопротивления на обмотке ДПКВ. В норме показания должны быть 550-750 Ом. Также существует метод, с помощью которого фиксируется индуктивность датчика синхронизации, но такую ​​диагностику сложнее реализовать в гараже и требуется дополнительное оборудование (вольтметр, сетевой трансформатор).

Следует отметить, что одним из быстрых тестов является установка заведомо исправного или нового датчика синхронизации.Если после замены двигатель запускается и работает нормально, то причина очевидна. Также нужно учитывать, что при установке датчика коленвала следует правильно выставить зазор, который присутствует между зубчатым шкивом и ДПКВ. При квалифицированной установке датчика предполагается, что зазор между сердечником датчика и синхронизирующим диском составляет 0,5 - 1,5 мм. Регулировка указанного зазора возможна установкой дополнительных шайб в месте гнезда датчика коленвала.

Подвести итог

Учитывая вышесказанное, можно сделать вывод, что датчик коленвала является одним из важнейших элементов в общей электронной схеме управления силовым агрегатом. Выход из строя ДПКВ приведет к полной остановке двигателя, сбои в его работе значительно усложнят эксплуатацию транспортного средства или сделают управление автомобилем практически невозможным.

По этой причине рекомендуется иметь запасной датчик коленчатого вала в автомобилях, на которых владельцы регулярно преодолевают значительные расстояния по шоссе.Также стоит добавить, что стоимость датчика коленвала для большинства отечественных и иномарок вполне доступна.

Что касается проверки и замены, то в самом начале следует убедиться, что в зазоре между датчиком и синхронизирующим диском нет посторонних предметов, а сам зазор находится в допустимых пределах. Параллельно следует учитывать, что прибор может быть исправным и работоспособным, а причина отказов - грязь на сердечнике ДПКВ.

Читайте также

Назначение и особенности ДПРВ (датчик положения распределительного вала) на бензиновых и дизельных двигателях... Проверка и замена датчика своими руками.

  • Почему стартер нормально крутится, а двигатель не подхватывает, не запускается. Основные причины неисправности, проверка систем подачи топлива, зажигания. Совет.
  • Назначение, устройство и принцип действия датчика положения коленчатого вала (датчик синхронизации). Как проверить и установить датчик коленвала.
  • Плохая тяга автомобиля. Не тянет двигатель, причины где искать

    /4
    Наихудшее

    Хозяин автомобиля субъективно воспринимает эту неисправность, замечая, что машина «ленилась», что двигатель «не тянет».«Но как точнее определить истинное состояние двигателя по мощностным параметрам? Для этого существуют вполне конкретные оценочные показатели. Максимальная скорость, развиваемая автомобилем, и время прохождения им 1 км пути при трогании с места с переключением передач. при интенсивном разгоне.Испытания для определения этих параметров автомобиля проводятся на горизонтальном прямолинейном участке дороги с ровным и твердым покрытием в сухую погоду без ветра. Участок дороги должен быть достаточной протяженности при полном движении. должна быть обеспечена безопасность (отсутствие встречного транспорта, пешеходов и т. д.). Все измерения производятся при движении в двух противоположных направлениях с закрытыми дверными стеклами и вентиляционным люком в передней части кузова. ходовой части транспортного средства (схождение и развал передних колес, давление в шинах, регулировка тормозных механизмов) и проверьте путь свободного качения (выбег) транспортного средства от постоянной скорости 50 км / ч до полной остановки. Для этого разгоните автомобиль на прямой передаче до 50 км / ч и двигайтесь с этой скоростью до заданного ориентира на дороге, например, индикатора километра: при проезде ориентира необходимо быстро выключить сцепление и сразу же двигаться. рычаг переключения передач в нейтральное положение.

    Этот тест проводится при движении в двух противоположных направлениях, и берется среднее значение, которое должно быть не менее 420 м. Нередко в процессе доводки до износа автомобиль становится «резвым», так как причиной его плохих динамических качеств был не двигатель, а неправильно отрегулированный схождение или «тугие» тормоза.

    Итак, что и где проверить, нет ли реакции дроссельной заслонки двигателя (двигатель не тянет).

    1. Проверьте все датчики.

    1.1. ДМРВ - датчик массового расхода воздуха. При неисправности смесь может быть слишком богатой (съест много бензина) или бедной - будет вяло разгоняться. Как попробовать проверить датчик самостоятельно: Если разгон вялый, отсоединить разъем датчика, запустить. Обороты холостого хода сразу станут высокими, загорится лампа «Проверить двигатель / проверить двигатель». Попробуй прокатиться в таком режиме. Если ускорение станет намного лучше (разницу вы почувствуете сразу), значит датчик явно неисправен.Можно попробовать аккуратно смыть керазином, но это ненадолго.

    Поскольку датчик дорогой, заменяйте воздушный фильтр каждые 5000 км, чтобы продлить срок его службы. больше всего они не любят падающий на них песок или пыль.

    1.2. ДПКВ - Датчик положения коленчатого вала. Проблемы с ним возникают редко, иногда достаточно очистить поверхность между шестерней и датчиком от грязи.

    1.3. Р.Х.Х. - регулятор холостого хода. Это шаговый двигатель. Иногда он заклинивает и является причиной того, что двигатель не запускается в холодную погоду.В случае неисправности обороты холостого хода могут «зависнуть», сильно плавать или двигатель заглохнет после отпускания дроссельной заслонки. Явным признаком неработающего датчика может быть работающий двигатель, но только при нажатой педали акселератора. После выпуска глохнет.

    1,4 ДПДЗ - датчик положения дроссельной заслонки ... Стоит на оси дроссельной заслонки. При выходе из строя педаль газа начинает работать нелинейно, обороты скачут, «замирают». Рекомендую установить датчик приближения (чуть дороже) и надолго забыть о его замене.

    1,5 DC - датчик кислорода. Следит за составом смеси. Он стоит перед катализаторами (в новых машинах их два - еще один после катализатора). Неисправный датчик также является причиной «тупого» разгона. Саму исправность определить сложно. Обычно контроллер прошивается, чтобы исключить этот датчик из работы.

    2. Проверить топливный насос.

    Работу бензонасоса обычно оценивают по давлению в рампе форсунок.Нормальным считается давление чуть больше 3 атмосфер. Лучше зайти и попробовать диагностику. Работа с бензином на горячем двигателе по-прежнему наиболее опасна. Стоит проверить сетку бензонасоса. Часто он забивается и сразу падает давление в рейке, что может существенно сказаться на разгоне.

    Плохие свечи - частые возгорания. Это заметно по тому, как плавают обороты на x.x. Рекомендую поставить проверенные (берите в престижных магазинах, чтобы не нарваться на подделку) - NGK и Brisk.По опыту эксплуатации - надежные лидеры в тестах «За рулем».

    4. Низкая компрессия в цилиндрах.

    Может из-за перегоревшего клапана (или сразу нескольких). Резко падает мощность двигателя и заметно увеличивается расход бензина. На 8-клапанных моторах клапаны необходимо периодически регулировать. Если этого не делать в течение длительного времени, то это может вызвать низкую компрессию и ее распространение по цилиндрам.

    Как правило, при длительной эксплуатации автомобиля практически каждый водитель рано или поздно замечает, что двигатель плохо тянет.Другими словами, силовой агрегат с трудом справляется с нагрузками, идет потеря, агрегат нужно раскручивать до высоких оборотов, чтобы поддерживать обычный темп, машина хуже разгоняется с места, медленно набирает скорость и т. Д.

    При этом мотор во многих случаях работает плавно, не троит, не стучит и не шумит при работе. Сразу отметим, что существует довольно широкий список возможных причин, по которым не тянет теплый двигатель, происходит потеря мощности двигателя в холодном и / или горячем состоянии.

    В этой статье мы поговорим о том, почему двигатель не тянет, а также рассмотрим наиболее частые неисправности, которые проявляются в виде потери тяги силового агрегата.

    Читайте в этой статье

    Мотор не тянет: основные причины снижения мощности двигателя

    Итак, если других симптомов, кроме потери тяги, не обнаружено, то необходимо сразу обращать внимание на качество топлива, исправность системы и т. Д.

    • Как показывает практика, более половины случаев снижения отдачи от ДВС связаны с топливом. Двигатель не тянет из-за того, что некачественное или неподходящее для этого типа моторное топливо (например, 92-й бензин вместо 95-го).

    В некоторых случаях после заправки также могут возникнуть проблемы с запуском двигателя, двигатель появляется. Для решения этой проблемы может быть достаточно разбавить имеющееся топливо более высокого качества.Реже возникает необходимость полностью слить топливо из бака, после чего проводится дополнительная промывка системы питания.

    Обычно такие манипуляции необходимы, когда параллельно с потерей тяги отмечается нестабильная работа ДВС, а под нагрузкой двигатель плохо заводится, на панели и т. Д.

    Также владельцы бензиновых двигателей могут самостоятельно определять качество бензина. Для проверки свечи зажигания необходимо открутить от двигателя.Нарушение процесса сгорания топливовоздушной смеси в цилиндрах, а также наличие примесей в топливе можно определить по саже на свечах зажигания и ее цвету.

    Например, если топливо содержит много сторонних металлосодержащих присадок и присадок, то юбка и электроды могут покрываться красноватыми углеродными отложениями (кирпичного цвета). Черная сажа будет свидетельствовать о том, что топливо не горит должным образом и т. Д. В любом случае сбои в процессе сгорания рабочей смеси приводят к тому, что двигатель перестает тянуть.

    • Следующий этап диагностики. Снижение КПД этих элементов сопровождается также падением мощности силового агрегата.

    Это особенно заметно при резких ускорениях, и когда автомобиль уже движется с большой скоростью. Другими словами, у мотора нет места для дальнейшего разгона.

    Свечи могут быть грязными, и не исключено, что их ресурс подошел к концу. Чтобы решить эту проблему, вы можете изготовить или сразу заменить весь комплект на новый.

    Важно учитывать, что если новые свечи зажигания правильно подобраны для конкретного двигателя по скорости накала и другим параметрам, но они все равно быстро загрязняются, то причина потери тяги не в их. Образование нагара в этом случае указывает на проблемы с смесеобразованием или сгоранием топливного заряда в цилиндрах.

    • Если со свечами все в порядке, то необходимо проверить состояние топливного и воздушного фильтра... В первом случае недостаточная пропускная способность может привести к тому, что необходимое количество топлива не будет подано в цилиндры для приготовления так называемой «силовой» смеси.

    В результате двигатель теряет мощность, то есть не тянет под нагрузками. В такой ситуации достаточно заменить указанный фильтрующий элемент. Что касается воздушного фильтра, проблема аналогична топливному фильтру, но в этом случае в воздушно-топливной смеси не хватает воздуха.

    Это приводит к тому, что топливо без достаточного количества кислорода сгорает не полностью.Мощность двигателя в таких условиях естественным образом падает, в камере сгорания образуется нагар, свечи сильно загрязняются и т. Д. Для устранения проблемы тоже необходимо заменить.

    Неисправности системы питания, розжига и нарушенное смесеобразование

    Если проблемы со свечами зажигания и фильтрами можно определить прямо в дороге, то более серьезные проблемы, связанные с питанием и системой зажигания, гораздо сложнее диагностировать и устранить на месте.В случаях, когда двигатель не набирает обороты, а при нажатии на педаль газа отмечаются рывки и провалы, необходимо проверить и / или форсунку.

    Давайте остановимся на более распространенном электронном впрыске. В списке основных неисправностей современных инжекторных двигателей внутреннего сгорания:

    • неисправности, снижение производительности или загрязнение сетчатого фильтра топливного насоса;
    • неисправности форсунок впрыска;
    • проблемы с датчиками или ЭБУ;
    • неисправности системы зажигания;
    • утечки воздуха и утечки в топливопроводах;

    Если говорить о системе зажигания, то помимо свечей зажигания следует еще проверить катушки зажигания и т. Д.Что касается подачи топлива, то на начальном этапе следует измерить давление в топливной рампе (рампе). Параллельно проверяется и регулятор давления в топливной рампе.

    Часто на многих автомобилях проблемы связаны с топливным насосом, который находится в бензобаке, а также с указанным регулятором. Для измерения давления топлива к рейке подключается манометр, полученные значения сравниваются с рекомендованными для конкретного двигателя. Если давление ниже нормы, то виновником может быть как бензонасос, так и регулятор давления.

    Задача регулятора - сбросить излишки топлива в обратную линию в то время, когда давление выше нормы. Если настройки потеряны, или сам регулятор протекает или неисправен, то топливо будет сливаться в обратную линию раньше времени. Чтобы это проверить, воздух нагнетается компрессором или насосом, давление в рейке увеличивается. Если регулятор срабатывает до достижения рекомендованного давления, элемент необходимо отрегулировать или заменить.

    Другие причины снижения мощности двигателя

    Состояние также имеет большое влияние на мощность двигателя.Дело в том, что для защиты окружающей среды от вредных выбросов при работе ДВС в выхлопе устанавливаются каталитические нейтрализаторы.

    Во время работы фильтр-катализатор может разрушиться, снижая пропускную способность выхлопной системы. В результате двигатель «задушен». Проверка осуществляется путем измерения давления до и после катализатора. Также можно снять элемент и визуально осмотреть его состояние.

    Как правило, официальные сервисы предлагают замену изношенного элемента, но цена запчасти очень высока.По этой причине на многих автомобилях в СНГ просто выбивают катализатор, а блок управления «обманывают» программным обеспечением или другими доступными методами.

    Также при снижении мощности двигателя необходимо отдельно проверить его, чтобы исключить возможность сбоя фаз газораспределения. Иногда возникают ситуации, когда ремень может проскочить на один зуб, цепь растянута и т. Д.

    В этом случае может нарушиться синхронная работа клапанного механизма по отношению к тактам ДВС.Это приводит к различным сбоям, нестабильной работе агрегата и снижению мощности.

    Добавляем также, что износ двигателя и определенные неисправности также влияют на мощность двигателя. Как правило, изношенные бывшие в употреблении двигатели внутреннего сгорания теряют около 10% заявленной мощности.

    Если водитель чувствует, что потерь больше, значит двигатель нужен. Низкая компрессия в цилиндрах может возникать в результате износа стенок цилиндров, поршневых колец, их неполного закрытия и т. Д.

    Так или иначе, любые утечки в камере сгорания приведут к тому, что расширяющиеся газы при сгорании топлива вырвутся наружу из цилиндра.Это значит, что давление этих газов на поршень будет уменьшаться, а сам ДВС будет плохо тянуть и работать нестабильно.

    Напоследок отметим, что также причиной того, что автомобиль потерял в динамике, может быть не двигатель, а трансмиссия. Другими словами, силовой агрегат развивает достаточную мощность, но она не полностью передается на колеса.

    Обычно это проявляется в том, что двигатель ревет, обороты высокие, но машина не движется, или ускорение очень медленное на низких передачах.Часто такие проблемы связаны со сцеплением или пробуксовкой АКПП, а также с заклиниванием тормозной системы ... Для проверки тормозов достаточно разогнать машину по ровной дороге, затем включить нейтральную передачу.

    Если при движении накатом заметно, что машина сразу стала тормозить, то проблема очевидна, колеса слегка заблокированы. Если проблем с тормозами не выявлено, то необходима диагностика АКПП. Лучше доверить эту процедуру опытным специалистам, сдав машину в сервис.

    Читайте также

    Назначение, конструктивные особенности, место установки регулятора давления топлива ТНВД. Признаки неисправности RTD, проверка устройства.

  • В результате появляются рывки и провалы при наборе скорости, машина дергается в движении на переходных режимах. Причины и устранение неисправностей.


  • Наверное, любой водитель сталкивался с такой проблемой, когда машина теряла былую динамику: долго разгоняется, а при подъеме вообще отказывается двигаться на повышенных передачах.В этой статье мы подробно расскажем, что делать, если двигатель ВАЗ не тянет или плохо тянет, рассмотрим основные причины и методы устранения неисправностей.

    Условно все типы бензиновых двигателей можно разделить на бензиновые и инжекторные. В целом принцип работы у них абсолютно одинаковый, однако факторы, влияющие на мощность двигателя, становятся разными. Рассмотрим отдельно проблему карбюратора и инжекторного двигателя.

    Не тянет карбюраторный двигатель ВАЗ

    Карбюратор - механическое устройство, предназначенное для смешивания воздуха и бензина с дальнейшей подачей этой смеси в камеру сгорания двигателя.Проблемы с недостаточной мощностью двигателя на карбюраторе встречаются довольно часто и тому есть множество причин. Мы постараемся разобраться с каждым.

    Прежде всего, потеря мощности двигателя может скрываться за системой питания. Как правило, двигатель не тянет из-за недостатка или избытка топлива. Дело в том, что бензин и воздух смешиваются в определенном соотношении. А если того или иного элемента не хватит, то мотор начнет работать нестабильно и перестанет развивать необходимую мощность.

    Соотношение воздух-топливо должно быть в пределах 15: 1. Если количество бензина превышает допустимые параметры, то он не сгорит полностью, а значит, снизится реакция двигателя на дроссельную заслонку. Кроме того, такое изменение передаточных чисел серьезно увеличит расход топлива и в дальнейшем приведет к другим неисправностям двигателя.

    Недостаточное количество топлива приводит к голоданию. Воспламенение топливно-воздушной смеси будет недостаточным, и поршень будет двигаться медленно.Все это достигается правильной настройкой карбюратора, точным подбором жиклеров и многими другими факторами.

    Начинается с выбора форсунок. Важным условием является наличие воздушной струи большего размера, чем газовая. Затем регулируется поплавковая камера карбюратора, которая должна быть заполнена бензином только наполовину. После этого заводится двигатель автомобиля и регулируется количество и качество топлива в соответствии с технической литературой на данную модель карбюратора. Если при этом достигается стабильное количество оборотов в диапазоне 800-900 об / мин, то настройка карбюратора прошла успешно.

    Еще одно звено в энергосистеме - наличие чистых воздушных и топливных фильтров. Если фильтры слишком грязные, то с большим трудом будет проходить топливо или воздух, что также нарушает состав смеси. Поэтому фильтры необходимо всегда содержать в чистоте.

    Проверьте также. Возможно, он не открывается полностью. В этом случае остановите двигатель и отрегулируйте положение дроссельной заслонки.

    Также вполне возможно, что бензонасос перестал создавать необходимое давление.Для этого нужно его снять и проверить. Не исключено, что придется поменять привод и его диафрагму. Есть еще одна очень частая неисправность - повышенный износ штока топливного насоса. Это означает, что вручную он качает идеально, и при запуске двигателя он работает некоторое время, затем он теряет мощность и двигатель глохнет.

    Газораспределительный механизм также играет важную роль в поддержании мощности двигателя. Если клапаны в процессе износа потеряли герметичность, то газы будут вырываться из камеры сгорания прямо в клапанный механизм.Все это снижает давление, создаваемое в цилиндрах двигателя, поэтому поршни двигаются заметно медленнее.

    Для восстановления герметичности клапанов необходимо их притереть и правильно отрегулировать. Суть регулировки заключается в установке тепловых зазоров в их ударном механизме. Размер зазоров указан в справочной литературе к двигателю автомобиля.

    Кроме того, клапанный механизм должен быть синхронизирован с коленчатым валом двигателя. Если открытие и закрытие клапанов не соответствует положению поршня, то двигатель не только будет плохо тянуть, но может вообще не запуститься.

    Пожалуй, решающий фактор. Искрение должно происходить только в строго заданных циклах, иначе мотор не только будет плохо тянуть, но и может перегреться и работать очень и очень нестабильно. Если регулировка УОЗ прошла успешно, а двигатель все равно не тянет, а на холостом ходу он полностью нестабилен, то имеет смысл проверить систему зажигания в целом.

    В бесконтактной системе зажигания необходимо убедиться, что переключатель работает. Для этого включите зажигание и проследите за положением стрелки вольтметра: сначала она должна отклониться на 12 Вольт, а через секунду подняться еще выше.Если вольтметр не предусмотрен конструкцией вашего автомобиля, то замените выключатель заведомо исправным и еще раз проверьте зажигание.

    В первую очередь обратите внимание на чистоту и герметичность контактов в трамблере. Если все в порядке, можно двигаться дальше. Запустите двигатель и по очереди вытащите высоковольтные провода. Слушайте, как двигатель работает после каждого провода. Если он начинает работать еще хуже, значит в этом цилиндре есть искра. Если работа двигателя не изменилась, значит, вы обнаружили неисправную свечу зажигания или высоковольтный кабель.Это предположение можно проверить, заменив элемент заведомо исправным.

    Неправильное использование свечей зажигания также влияет на работу двигателя. Чаще всего разница свечей заключается в зазорах между электродами. Размер зазора должен соответствовать двигателю, сезону эксплуатации автомобиля и модели свечи.

    Проверить распределитель зажигания. Возможно, в нем сгорел резистор в цепи ротора. Еще одна проблема - неплотное прилегание контактного угля.Попробуйте заменить ее или пружину.

    Последняя проблема с зажиганием - нечеткая работа октан-корректора. При отсутствии необходимого вакуума специальная пластина не возвращается в исходное положение. Кроме того, в системе наблюдается повышенный люфт. Устраните это и замените все дефектные детали. Проверить шланг на герметичность.

    Последняя и самая страшная неисправность - это. Эти элементы предназначены для уменьшения трения поршня о стенку цилиндра двигателя и удаления остатков масла, чтобы оно не попало в камеру сгорания двигателя.

    Неисправность колец приводит к нарушению герметичности камеры сгорания, в связи с чем серьезно снижается компрессия цилиндра. Определить это можно по повышенному расходу масла и соответствующему цвету выхлопных газов ... В этом случае поможет только серьезный ремонт двигателя.

    Выхлопная часть автомобиля также играет важную роль в создании необходимого давления в цилиндрах двигателя. Если эта разница давлений между входом и выходом нарушена, то тяга двигателя может заметно снизиться.В этом случае проверьте, не загрязнена ли выхлопная система: трубы необходимо снять и осмотреть. Особое внимание уделите передней трубе. Если в нем будут отверстия, он потеряет герметичность и придет в негодность.

    Если в резонаторе, трубах или глушителе есть лишние отверстия или повреждения, их необходимо заменить в обязательном порядке.

    Плохо тянет инжекторный двигатель

    Некоторые неисправности карбюраторного двигателя смело можно отнести к неисправностям инжекторного двигателя.Это касается механизма газораспределения, фильтров, системы зажигания, выхлопной и поршневой группы двигателя.

    • Неисправность бензонасоса

    Главная особенность инжекторного двигателя - наличие бензонасоса с электроприводом. Он представляет собой электрический двигатель, который создает разрежение и нагнетает в топливную систему необходимое количество топлива.

    Влияет на стабильность оборотов двигателя. Ведь если он будет работать с перебоями, то бензин будет подаваться в соответствующем количестве.Чаще всего виновата электропроводка, реле бензонасоса или контактная группа электросхемы. В этом случае необходимо провести диагностику и ремонт неисправного топливного насоса.

    Еще одна проблема бензонасоса - повышенное загрязнение его фильтра. Измерьте давление на выходе и сравните его со стандартными значениями. Если результат измерения не соответствует контрольным значениям, то необходимо очистить фильтр топливного насоса.

    Форсунка - это небольшой электромагнитный клапан, который в определенный момент времени распыляет топливно-воздушную смесь в камеру сгорания двигателя.Мощность двигателя также зависит от правильной работы форсунок.

    Диагностика их исправности проводится с помощью мультиметра. Для этого необходимо проверить сопротивление обмоток на обрыв и короткое замыкание. При обнаружении их неисправности форсунки подлежат замене.

    Датчики являются основным сборщиком информации для работы электронного блока управления. В случае выхода из строя одного из датчиков, контроллер, не получив необходимой информации, мгновенно переводит мотор в аварийный режим с соответствующей лампой на двигателе приборной панели.

    Неисправный датчик можно вычислить, проведя электронную диагностику на станции Техническое обслуживание и замену.

    • Неисправность самого ЭБУ

    Электронный блок управления тоже может дать сбой. Чтобы проверить его работоспособность, необходимо заменить на заведомо исправный и проверить работу двигателя. Напряжение, подаваемое на блок, должно составлять 12 вольт.

    Видео - Двигатель не тянет на малых оборотах, машина не едет в гору

    По статистике каждый автовладелец при длительной эксплуатации автомобиля испытывает проблемы с тягой, в зависимости от причин машина либо плохо разгонялась, либо вообще не могла двигаться.Другими словами, двигателю просто не хватает мощности, чтобы справиться со всеми нагрузками - набрать обороты и обороты.

    Приборная панель

    Самое интересное, что мотор ведет себя в таких ситуациях как полностью «исправный». Вы не услышите от него ни шума, ни стука, ни других признаков неисправности. Сразу отмечу, что список возможных причин потери мощности огромен и описать все неисправности очень сложно. Мы приведем список только наиболее часто встречающихся, а также подробно проанализируем их характер и возможные причины появления.

    Основные причины потери мощности

    Если в пути других проблем не обнаружено, как только происходит потеря тяги, то в первую очередь стоит обратить внимание на качество. Как гласит практика, в 51% случаев некачественное топливо связано с потерей мощности. Бак заправлен плохим или неподходящим для этой модели топливом. Нередко современные автомобили, особенно иномарки, плохо переносят 92 марки бензина. Иногда это можно сделать довольно просто, достаточно развести более качественное топливо... Часто такие манипуляции помогают при нестабильной работе ДВС, "оборотов" и тому подобном. Потом по пути наблюдается "" на приборке.

    Владельцы бензиновых двигателей могут легко проверить качество, посмотрев на свечи. Если причина кроется в нарушениях горения, а также наличии примесей, это отобразится на свечах, появится сажа, изменится цвет.

    Например, при перенасыщении топлива сторонними металлосодержащими компонентами юбка и контакты будут покрываться красноватым оттенком.Образование сажи свидетельствует о неполном сгорании смеси. В любой ситуации при сбоях в процессах сгорания двигатель теряет мощность.

    Также не забывайте, что при проверке свечей нужно помнить о сроке службы. Они не долговечны, особенно если изначально были невысокого качества. А теперь интересный факт, если после замены всего комплекта свечей зажигания так же быстро образуется «накипь» и у двигателя такие же проблемы, то причину следует искать в фильтрах или цилиндрах.

    Проблемы с фазами газораспределения возникают из-за неправильно установленных «меток» ремня, цепи ГРМ. Ремни натягиваются, цепи прыгают, после чего из-за незнания проблем последствия могут быть намного печальнее.

    Банальный износ двигателя. Не забывайте, что подержанные автомобили теряют в среднем 10-15% мощности. Если, по вашему мнению, потери мощности намного больше, тогда стоит проверить компрессию. Слабое сжатие, а оно часто меньше 10 кг / м. указывает на прогорание стенок цилиндров, износ колец, прогорание клапанов и т.п.Данные о компрессии для каждой модели разные, но обычно она составляет 12-14 кг / м3. Подробнее о том, какой у вас, можно узнать в сервисной книжке.

    Причины в трансмиссии. Изношено сцепление в МКПП или пробуксовывает АКПП. Проверку лучше доверить опытным мастерам, особенно АКПП.

    В процессе эксплуатации автомобиля многие владельцы сталкиваются с рядом проблем. Один из них - снижение мощности двигателя.При этом не всегда понятно, в чем причина этого явления, какие меры предпринять, стоит ли ехать на СТО. Поговорим об основных причинах, по которым двигатель не тянет и как можно исправить проблему своими силами.

    Основные причины снижения мощности двигателя

    1. Неисправность датчика положения коленвала

    Бывают ситуации, когда ДКПВ несвоевременно подает команду управления на подачу топливовоздушной смеси.В результате мощность силового агрегата падает на глазах. Основная причина выхода из строя - смещение звездочки относительно шкива и отслоение демпфера. В такой ситуации необходимо внимательно осмотреть демпфер и заменить его.

    2. Увеличить (уменьшить) зазор между электродами свечей

    В процессе эксплуатации из-за мощного температурного воздействия расстояние между электродами свечи может уменьшаться или увеличиваться. Чтобы исключить или подтвердить свое подозрение, нужно проверить размер зазоров круглым щупом.Если расстояние меньше или больше допустимого, нужно отрегулировать, отогнув сторону электрода или заменив свечу зажигания. Что касается оптимального расстояния искрового промежутка, то оно может быть разным (в зависимости от типа свечи зажигания) - 0,7-1,0 мм.

    3. Появление нагара на свечах - еще один явный признак проблемы.

    Если двигатель плохо тянет, необходимо по очереди открутить все свечи зажигания и осмотреть их. Если на электродах появился явный нагар, устройство необходимо очистить щеткой с металлической щетиной.В этом случае важно не только очистить свечи или заменить их, но и выяснить причину этого явления.

    4. Отказ свечей зажигания

    Снижение мощности двигателя может быть вызвано неисправностью изделия. В этом случае необходимо проверить работоспособность свечи на специальном стенде. Если подозрения подтвердятся, то единственный выход - заменить комплект или одну свечу.

    5. Нет бензина в баке

    Вы можете диагностировать проблему по указателю уровня топлива.Если он неисправен или есть подозрение на его «неполноценность», то наличие топлива можно определить, сняв топливный насос.

    6. Загрязнение топливного фильтра, замерзание воды в системе, защемление топливопровода, выход из строя топливного насоса

    Все эти неисправности смело можно отнести к одной категории, ведь все они имеют одинаковые признаки - стартер проворачивает двигатель, но запаха топлива из выхлопной трубы нет. Если автомобиль карбюраторный, то причину нужно искать в поплавковой камере.Скорее всего, он не заправлен топливом. В случае форсунки наличие топлива в рейке легче проверить, нажав на специальную катушку (устанавливается на конце рейки).

    Для устранения проблемы нужно тщательно прогреть двигатель и прокачать систему питания шинным насосом. После этого меняют все патрубки системы, шланги и сам бензонасос.

    7. Топливный насос создает слишком низкое давление

    Эту проблему можно определить исключительно специальными замерами (производятся непосредственно на выходе из топливного насоса).После этого проверяется качество фильтра бензонасоса.

    Решение - очистить фильтр топливного насоса, заменить его (если ремонт невозможен) или установить новый топливный насос.

    8. Плохое качество контакта в цепи

    Некачественный контакт в цепи питания топливного насоса или выход из строя его реле. Первое, что нужно сделать для проверки, это убедиться в качестве «массы» на автомобиле и измерить сопротивление мультиметром. Если уровень сопротивления действительно завышен, то единственный выход - очистить контактные группы, хорошо обжать клеммы или установить реле (если старое вышло из строя).

    9. Поломка форсунок или неисправность в системе подачи

    При подозрении на выход из строя этих элементов необходимо проверить сопротивление обмоток мультиметром на факт обрыва или межвиткового замыкания. Если причина проблемы - неисправность компьютера, то такую ​​проверку можно провести исключительно на СТО.

    Устранить снижение мощности двигателя по этой причине (в зависимости от глубины проблемы) можно несколькими способами - установить новый ЭБУ, прочистить все форсунки, обеспечить качественный контакт в электрической цепи и так далее.

    10. Разбивка ДПКВ

    Поломка ДПКВ - датчика положения коленвала или повреждение его цепи. В такой ситуации загорается лампа неисправности двигателя «Проверьте двигатель». Первым делом необходимо проверить целостность самого ДКПВ, чтобы убедиться, что зазор между зубчатым венцом и датчиком в норме (он должен быть около одного миллиметра). Нормальное сопротивление катушки датчика порядка 600-700 Ом.

    Для решения проблемы достаточно восстановить нормальный контакт в электрической цепи и установить новый датчик (если старый оказался неисправным).

    11. ДТОЖ вышедший из строя

    Вышел из строя

    ДТОЖ - датчик, контролирующий температуру охлаждающей жидкости. Симптомы неисправности следующие - загорается лампа неисправности двигателя. Если происходит обрыв, то электровентилятор системы начинает непрерывно вращаться. Кроме того, необходимо проверить исправность самого датчика.

    Если по этой причине упала мощность двигателя, то необходимо восстановить качество контакта в электрической цепи и установить новый датчик.

    12. Неудачный TPS

    Неисправен ДПДЗ - датчик, контролирующий правильное положение дроссельной заслонки (или ее цепи). Как и в предыдущих случаях, здесь горит лампа «Проверьте двигатель». Если в цепи ДПДЗ есть обрыв, то обороты двигателя обычно не опускаются ниже полутора тысяч оборотов.

    Решение проблемы - очистить дроссельный узел и восстановить качество контактного соединения во всей электрической цепи.Если датчик неисправен и не подлежит ремонту, его необходимо заменить.

    13. ДМРВ вышла из строя

    Неисправен ДМРВ - датчик, отвечающий за контроль массового расхода топлива. Здесь оптимальное действие - проверить целостность датчика массового расхода воздуха или заменить его исправным устройством. Если подтверждается выход из строя датчика массового расхода воздуха, то необходимо предпринять попытку его очистки, а при невозможности ремонта просто заменить.

    14. Обрыв датчика детонации

    Повреждение датчика детонации. При возникновении такой неисправности на панели приборов должна загореться лампа неисправности двигателя.Кроме того, при выходе из строя детонационного ДД детонация отсутствует ни в одном из режимов работы силового агрегата и мощность двигателя также снижается. При такой проблеме лучший вариант - восстановить целостность контактной группы в электрической цепи и установить новый датчик.

    15. Обрыв датчика кислорода

    Поломка кислородного датчика или нарушение его цепи.Для такой неисправности характерно загорание лампы «Проверьте двигатель». В этом случае первым делом необходимо проверить нагревательную спираль на целостность. Сначала измеряется сопротивление, а во-вторых, уровень напряжения на выходе. Измерение можно проводить даже без разрыва цепи - достаточно проткнуть изоляцию иглами.

    Для устранения неисправности стоит отремонтировать кислородный датчик, восстановив качество проводки и прочистив все отверстия, через которые засасывается воздух.В крайнем случае необходимо заменить сам кислородный датчик.

    16. Сброс давления в выхлопной системе

    Диагностировать такую ​​проблему несложно - достаточно осмотреть основные элементы при работе двигателя на средних оборотах. Для решения проблемы необходимо заменить прокладку выпускного коллектора и растянуть все сальники.

    17. Отказ ЭБУ

    Отказ электронного блока управления (ЭБУ). Несмотря на свою надежность, ЭБУ тоже может выйти из строя (иногда его программное обеспечение просто теряется).Чтобы убедиться, что он исправен (выход из строя ЭБУ), необходимо проверить напряжение на самом блоке (нормальный параметр около 12 Вольт) или заменить его на заведомо исправный блок. Если блок управления неисправен, возможно, его необходимо заменить. В некоторых случаях достаточно поменять только проводку.

    18. Нарушение регулировки зазора в приводе клапана

    Соответствие параметров можно проверить только с помощью специальных щупов.Если зазоры не правильные (написано в руководстве), то необходимо произвести регулировку.

    19. Деформация или поломка пружин клапана

    В этом случае придется снять головку блока цилиндров и измерить длину пружин под нагрузкой и в свободном состоянии. Если были обнаружены сломанные или деформированные пружины, то их нужно заменить.

    20. Изношены кулачки распределительного вала

    Здесь будет достаточно визуального осмотра (после снятия необходимых элементов) и замены распредвала при необходимости.

    21. Обрыв фаз газораспределения

    В таких случаях необходимо проверить совпадение меток на распредвале и коленвале. Если есть «неуравновешенность», то достаточно установить правильное положение по специальным отметкам.

    22. Низкий уровень компрессии в цилиндрах

    Низкий уровень компрессии во всех или некоторых цилиндрах. Причины включают вероятное повреждение клапана или износ, поломку или заедание поршневых колец. Чтобы убедиться в подозрениях или опровергнуть их, достаточно произвести необходимые замеры.Если подозрение подтвердилось, то необходимо отремонтировать силовой агрегат - поменять кольца, поршни или отремонтировать цилиндры.

    Вывод

    Вышесказанное - лишь часть неисправностей, из-за которых падает мощность двигателя. Но в большинстве случаев этого достаточно, чтобы диагностировать проблему, устранить ее и вернуть своему «железному коню». Очень нужна тяга.

    причин и диагностики. Неисправности системы питания, розжига и нарушенное смесеобразование

    Многим хоть раз приходилось сталкиваться с ситуацией, когда мотор, который до этого отлично работал, «сдувает», машина как бы срастает якорь сзади.Причины, по которым двигатель не тянет и не набирает обороты, различны, но распознать признаки большинства несложно без навыков автомобильного диагноста или автосервиса.

    Общие причины для всех двигателей

    Характеристики мотора, указанные в паспортных данных автомобиля, предоставляются при определенных условиях. Это нормальное заполнение цилиндров воздухом, который является рабочим телом в двигателе внутреннего сгорания. Это способность вовремя нагреть его до желаемой температуры - подать определенное количество топлива надлежащего качества и вовремя поджечь (пик давления для максимальной эффективности должен происходить в момент пересечения поршнем верхней мертвой точки. ).

    Рабочий цикл ДВС

    Потеря мощности двигателя, независимо от его конструкции, является результатом ряда распространенных причин ... Начнем с топлива: его качество остается лотерейным, а двигатель настроен на определенную оценка. То есть смесь, прописанная в картах впрыска, или смесь, указанная настройками карбюратора, может пойти не идеальной, и скорость горения смеси изменится. Итак, если проблемы возникли сразу после заправки, вы и сами знаете, в какую сторону искать.

    Наполнение цилиндров воздухом жестко связано с фазой газораспределения. Достаточно оставить следы, как штанги, работа ДВС сместится: уже разница в 1 зуб может существенно снизить мощность мотора. Причем ремню или цепям не обязательно прыгать - все больше моторов получают шкивы без ключа, которые при установке требуют жесткой фиксации валов специальными приспособлениями. Если вы не дотянетесь до шкива, и однажды он сдвинется с заданного положения.И хорошо, если двигатель просто теряет тягу, и не ударяет поршнем по не закрывшимся вовремя клапанам, загоняя их в ГБЦ.

    В двигателях с регулируемыми фазами газораспределения распределительные валы (по крайней мере, один) имеют возможность смещения таким образом, чтобы при достаточном отклике дроссельной заслонки внизу (малое перекрытие фаз) они не теряли вверху (распредвалы смещены " навстречу друг другу », увеличивая фазу перекрытия, что на высоких оборотах увеличивает мощность). Возможные причины, по которым автомобиль не набирает скорость, - это выход из строя регулирующего клапана VVTi или проблемы с муфтами фазовращателя.Мы уже обсуждали этот вопрос, говоря о.

    Кроме того, наполнение цилиндра зависит от сопротивления впуску и выпуску. Забейте воздушный фильтр настолько, что он потеряет свою пропускную способность - это должно быть надумано, но выбросы масла через систему вентиляции картера, особенно если поршень уже изношен, а маслоуловитель примитивен, не редкость. На ВАЗ-2106 не сложно заставить двигатель «потягивать масло» через вентиляцию картера, а на свежих переднеприводных автомобилях (2109, 2110, 2114) такие случаи возможны.Резко возрастает сопротивление масляного воздушного фильтра, отсюда и потеря тяги двигателя.

    Выпуск на карбюраторные автомобили и старые дизельные двигатели прост, и достаточно существенно уменьшить поперечное сечение, чтобы двигатель начал «задыхаться» выхлопными газами, возможно, при мощном ударе (при движении по неровностям, например ) или каноническая картошка - но это хоть сразу заметно.

    Если двигатель с электронным впрыском не тянет, то в этом случае под подозрение попадает катализатор.Перегрев, попадание топлива из-за неисправностей в системе питания может вызвать спекание ее сот. Для дизельных двигателей с сажевыми фильтрами сажа становится главным врагом: автоматическое сжигание фильтра на ходу малоэффективно, и необходимо проводить как минимум принудительную регенерацию.

    Проблемы с выпуском легко выдаются сами за себя: заглушенный двигатель при следующей попытке запуска выбрасывает дым в воздухозаборник, звук двигателя меняется, течи сразу «вылезают наружу» (выхлоп начинает «хлестать» в сторону поврежденный участок).

    Двигатель должен не только получать необходимое количество воздуха и топлива - он должен вовремя зажигаться. На бензиновом двигателе необходима соответствующая установка угла опережения зажигания, на дизельном двигателе - установка угла опережения впрыска. Поскольку на современных инжекторных двигателях нет отдельной системы зажигания, проблемы с опережением зажигания характерны в первую очередь для карбюраторных машин и старых систем впрыска с трамблером (японцы использовали такие системы вплоть до начала 2000-х). Проверить регулируемый распределителем основной угол опережения и работу в нем опережающих автоматов (при неисправностях угол нормальный на холостом ходу, начнет «уходить» при разгоне).

    Отдельный случай - моторы, у которых распределитель приводится в движение отдельным шкивом от ремня ГРМ (старые Audi и Volkswagens). Здесь при замене ремня шкив распределителя выставляют «как надо» (на этом шкиве нет отметок!), Забывая, что при замене ремня распределитель нужно ориентировать кулачком по риску на картере под Это. После такой замены машина перестает ехать, так как меняются углы зажигания. Для дизелей с механическим ТНВД задается начальный угол впрыска, кроме того, работает регулятор опережения - они проверяются по данным из инструкции по ремонту и обслуживанию.

    По бензиновым двигателям Еще к подозреваемым добавляем свечи зажигания: даже если двигатель нормально работает на холостом ходу, не факт, что свечи зажигания будут хорошо работать под нагрузкой, когда давление в цилиндрах в конце сжатия инсульт увеличивается, а условия искрообразования ухудшаются. Стоит приложить для теста еще один комплект: без осциллографа, позволяющего снимать кривые напряжения с исправной системы зажигания, сложно определить, как на самом деле ведет себя вилка под нагрузкой.На иллюстрации ниже посмотрите на пиковые напряжения, соответствующие моменту искрения: зазор в третьем цилиндре чрезмерно увеличен, искра зажигается при слишком высоком напряжении, и ее продолжительность уменьшается (мощность, накопленная в катушке зажигания, не достаточно для нормального горения искры).

    Если говорить о компрессии, то в нормальных условиях она уменьшается с износом настолько медленно, что снижение мощности происходит незаметно для водителя. Исключение составляют быстро развивающиеся поломки (трещины поршневых колец, разрушение перегородок между кольцами,).Одновременно с падением мощности резко упадет стабильность на холостом ходу, окончательную диагностику однозначно поставит компрессор.

    Что касается двигателей с турбонаддувом, то состояние турбокомпрессора хорошо отражается на их динамике. Идеальный центробежный насос (рабочее колесо турбонагнетателя) имеет квадратичную зависимость производительности от числа оборотов: как только число оборотов падает вдвое, давление наддува падает в четыре раза. Заклинивание ротора из-за разрушения или закоксовывания подшипников, прогорания «горячего» рабочего колеса - вероятная причина того, что турбированная машина не тянет.Здесь, как и с компрессией, выручит манометр.

    Причины потери мощности в карбюраторном двигателе

    Тут стоит сразу проверить уровень топлива и работу ТНВД: «недолив» топливо сразу выдаёт себя под нагрузкой с потерей динамики, выстрелы в карбюратор. Переполнение из-за неисправной стопорной иглы карбюратора также приведет к потере мощности двигателем, здесь черный дым и стрельба из глушителя уже станут характерной чертой.

    Динамика автомобиля лучше воспринимается при разгоне, так что возможной причиной неисправности ускорительного насоса также может стать «тупость» машины. Дело в том, что все карбюраторные системы рассчитаны на работу в статических режимах, при этом смесь переобеднена при разгоне. Для борьбы с этим перенаселенностью используется ускорительный насос: при нажатии на педаль газа диафрагма проталкивает дозу бензина через запорный клапан в форсунки, которые входят в диффузоры.При разрыве диафрагмы ускорительного насоса или засорении форсунок ускорение машины сразу ухудшится настолько, что это сложно не заметить. Проверить ускорительный насос несложно - после снятия воздушного фильтра или «черепахи» с карбюратора нужно резко нажать на приводной дроссель: пальцы почувствуют сопротивление (диафрагма создаст давление в ускорительном насосе), и потечет бензина должно попасть во впускное отверстие из форсунок.

    В рабочих режимах состав топливовоздушной смеси задается статически комплектом топливных и воздушных жиклеров. Стоит их продуть, а в случае заметных отложений промыть очистителем: даже если это не проблема, не лишним будет поддержать исправность основной системы дозирования.

    Не тянет двигатель впрыска

    Почему автомобиль не тянет, если системы впрыска оснащены обратной связью и могут саморегулироваться в «замкнутом контуре»? Увы, возможности саморегулирования не так широки, как хотелось бы.

    Первый враг систем впрыска - недостаточное давление топлива. При минимальном расходе топлива запас коррекции достаточен для холостого хода. Но как только двигатель будет загружен, поправка перескочит до максимального порога, но форсунки все равно будут «недоливать».

    Давление в топливной рампе регулируется тремя узлами: самим топливным насосом, регулятором давления и комплектом фильтров (грубой и тонкой). Производительность исправного топливного насоса в несколько раз превышает потребности двигателя при максимальном расходе - это сделано для того, чтобы износ насоса как можно меньше влиял на работу двигателя.Поэтому используется регулятор давления топлива, который сбрасывает «лишнее» топливо либо сразу на выходе насоса, либо из топливной рампы после фильтра тонкой очистки.

    В первом случае топливная рампа называется бессточной (16-клапанные двигатели ВАЗ, современные иномарки), во втором - сливной. Разница между этими системами заключается в расположении регулятора и в его работе. На сливных пандусах регуляторы давления управляются разрежением во впускном коллекторе, давление в пандусе меняется в зависимости от нагрузки (при нормальных 3 барах для ВАЗа на холостом ходу оно равно 2.3-2,4 бар, учтите это при диагностике!). Давление поддерживается постоянным по отношению к атмосфере на недренажных трубах и составляет, в зависимости от модели автомобиля, 3,5–4 бара. Исключение - системы прямого впрыска, где рабочее давление составляет от 20 до 70 бар.

    Еще что вам пригодится:

    На сопротивление топливных фильтров не влияет при замере давления топлива «в пробке» (на заглушенном двигателе принудительно включается насос при отсутствии потока топлива в рейка) и минимальна на холостом ходу.Но с другой стороны, под нагрузкой чрезмерное увеличение сопротивления фильтра снижает подачу топлива в рейку, что приведет к потере скорости. Поэтому измеряйте давление на холостом ходу и под нагрузкой (например, подвешивая ведущий мост и притормаживая колеса на включенной передаче). В случаях, когда холостой ход в норме, а проблемы возникают на ходу, бессмысленно измерять давление только на холостом ходу (ХХ).

    Проверка ступеней исключения:

    1. Снимите фильтр грубой очистки («Сетка» на входе).Это известная проблема в ряде автомобилей - например, на «Фокусах» второго поколения.
    2. Заменить фильтр тонкой очистки.
    3. Измерьте давление под нагрузкой.
    4. На двигателях со сливной рампой защемите или иным образом заглушите обратную линию, чтобы исключить влияние регулятора давления топлива. На моторах с дренажной аппарелью РДТ устанавливается в модуле топливного насоса, здесь проще временно установить пробку-шайбу из полиэтилена или другого материала, не разрушаемого бензином под ней.
    5. Измерьте давление еще раз: если оно увеличилось, необходимо заменить RTD, в противном случае необходимо заменить насос.

    Вторая причина - «недолив» -. Даже при нормальной работе фильтров со временем неизбежно образование отложений на форсунках. Только форму распылительной горелки можно оценить в домашних условиях, сняв аппарель и проворачивая мотор стартером (Внимание! Данная процедура пожароопасна!). Чистая насадка должна равномерно «пылиться», а не разбрызгиваться или выливаться в сторону.Оценить работу форсунок и сравнить с номинальной можно только на стенде.

    Потеря динамики - следствие чрезмерного обогащения смеси. Здесь нельзя винить регулятор давления топлива (производительность насоса даже при работе без RTD не настолько высока, чтобы запас коррекции ЭБУ впрыска не перекрывал обогащение). Гораздо вероятнее, что подтекают форсунки (опять же проверяется на стенде) или выход из строя датчиков, на которых завязан расчет времени впрыска.

    Здесь безусловный лидер - датчик массового расхода воздуха - точный, но чувствительный прибор. По мере загрязнения и старения датчика массового расхода воздуха показания завышаются, автомобиль начинает потреблять значительно больше топлива. В результате переобогащение смеси больше не может быть исправлено с помощью. Но такая неисправность видна сразу: машина начнет дымить, свечи зарастут черным нагаром. На моторах с датчиком абсолютного давления чаще выходит из строя датчик температуры воздуха (здесь он отдельный блок, а в датчик массового расхода воздуха он встроен).

    На автомобилях с электронной дроссельной заслонкой стоит проверить работу сервопривода, сняв сопло с дроссельной заслонки и дав ему подать газ. Дроссельная заслонка должна открываться равномерно, без пауз и заклинивания, что свидетельствует о проблемах с приводом или редуктором (ось, заросшая нагаром, клинья в корпусе).

    Видео: пропало питание. Потеря мощности

    Уплотнение

    В процессе эксплуатации автомобиля многие владельцы сталкиваются с рядом проблем.Один из них - снижение мощности двигателя. При этом не всегда понятно, в чем причина этого явления, какие меры предпринять, стоит ли ехать на СТО. Поговорим об основных причинах, по которым двигатель не тянет и как можно исправить проблему своими силами.

    Основные причины снижения мощности двигателя

    1. Неисправность датчика положения коленвала

    Бывают ситуации, когда ДКПВ несвоевременно подает команду управления на подачу топливовоздушной смеси.В результате мощность силового агрегата падает на глазах. Основная причина выхода из строя - смещение зубчатой ​​звезды по отношению к шкиву и отслоение демпфера. В такой ситуации необходимо внимательно осмотреть демпфер и заменить его.

    2. Увеличить (уменьшить) зазор между электродами свечей

    В процессе эксплуатации из-за мощного температурного воздействия расстояние между электродами свечи может уменьшаться или увеличиваться.Чтобы исключить или подтвердить свое подозрение, нужно проверить размер зазоров круглым щупом. Если расстояние меньше или больше допустимого, нужно отрегулировать, отогнув сторону электрода или заменив свечу зажигания. Что касается оптимального расстояния искрового промежутка, то оно может быть разным (в зависимости от типа свечи зажигания) - 0,7-1,0 мм.

    3. Появление нагара на свечах - еще один явный признак проблемы.

    Если двигатель плохо тянет, необходимо по очереди открутить все свечи зажигания и осмотреть их.Если на электродах появился явный нагар, устройство необходимо очистить щеткой с металлической щетиной. В этом случае важно не только очистить свечи или заменить их, но и выяснить причину этого явления.

    4. Отказ свечей зажигания

    Снижение мощности двигателя может быть вызвано неисправностью изделия. В этом случае необходимо проверить работоспособность свечи на специальном стенде. Если подозрения подтвердятся, то единственный выход - заменить комплект или одну свечу.

    5. Нет бензина в баке

    Вы можете диагностировать проблему по указателю уровня топлива. Если он неисправен или есть подозрение на его «неполноценность», то наличие топлива можно определить, сняв топливный насос.

    6. Загрязнение топливного фильтра, замерзание воды в системе, защемление топливопровода, выход из строя топливного насоса

    Все эти неисправности смело можно отнести к одной категории, ведь все они имеют одинаковые признаки - стартер проворачивает двигатель, но запаха топлива из выхлопной трубы нет.Если автомобиль карбюраторный, то причину нужно искать в поплавковой камере. Скорее всего, он не заправлен топливом. В случае форсунки наличие топлива в рейке легче проверить, нажав на специальную катушку (устанавливается в конце рейки).

    Для устранения проблемы нужно хорошенько прогреть двигатель и прокачать систему питания шинным насосом. После этого меняют все патрубки системы, шланги и сам бензонасос.

    7. Топливный насос создает слишком низкое давление

    Эту проблему можно определить исключительно специальными замерами (производятся непосредственно на выходе из топливного насоса).После этого проверяется качество фильтра бензонасоса.

    Решение - очистить фильтр топливного насоса, заменить его (если ремонт невозможен) или установить новый топливный насос.

    8. Плохое качество контакта в цепи

    Некачественный контакт в цепи питания топливного насоса или выход из строя его реле. Первое, что нужно сделать для проверки, это убедиться в качестве «массы» на автомобиле и измерить сопротивление мультиметром. Если уровень сопротивления действительно завышен, то единственный выход - очистить контактные группы, хорошо обжать клеммы или установить реле (если старое вышло из строя).

    9. Поломка форсунок или неисправность в системе подачи

    При подозрении на выход из строя этих элементов необходимо проверить сопротивление обмоток мультиметром на факт обрыва или межвиткового замыкания. Если причина проблемы - неисправность компьютера, то такую ​​проверку можно провести исключительно на СТО.

    Устранить снижение мощности двигателя по этой причине можно несколькими способами (в зависимости от глубины проблемы) - установить новый ЭБУ, прочистить все форсунки, обеспечить качественный контакт в электрической цепи и т. Д. .

    10. Поломка ДПКВ

    Поломка ДПКВ - датчика положения коленвала или повреждение его цепи. В такой ситуации загорается лампа неисправности двигателя «Проверьте двигатель». Первым делом необходимо проверить целостность самого ДКПВ, чтобы убедиться, что зазор между зубчатым венцом и датчиком в норме (он должен быть около одного миллиметра). Нормальное сопротивление катушки датчика порядка 600-700 Ом.

    Для решения проблемы достаточно восстановить нормальный контакт в электрической цепи и установить новый датчик (если старый оказался неисправным).

    11. ДТОЖ вышедший из строя

    Вышел из строя

    ДТОЖ - датчик, контролирующий температуру охлаждающей жидкости. Симптомы неисправности следующие - загорается лампа неисправности двигателя. Если происходит обрыв, то электровентилятор системы начинает непрерывно вращаться. Кроме того, необходимо проверить исправность самого датчика.

    Если по этой причине упала мощность двигателя, то необходимо восстановить качество контакта в электрической цепи и установить новый датчик.

    12. Неудачный TPS

    Неисправен ДПДЗ - датчик, контролирующий правильное положение дроссельной заслонки (или ее цепи). Как и в предыдущих случаях, здесь горит лампа «Проверьте двигатель». Если в цепи ДПДЗ есть обрыв, то обороты двигателя обычно не опускаются ниже полутора тысяч оборотов.

    Решение проблемы - очистить дроссельный узел и восстановить качество контактного соединения во всей электрической цепи.Если датчик неисправен и не подлежит ремонту, его необходимо заменить.

    13. ДМРВ вышла из строя

    Неисправен ДМРВ - датчик, отвечающий за контроль массового расхода топлива. Здесь оптимальное действие - проверить целостность датчика массового расхода воздуха или заменить его исправным устройством. Если подтверждается выход из строя датчика массового расхода воздуха, то необходимо предпринять попытку его очистки, а при невозможности ремонта просто заменить.

    14. Обрыв датчика детонации

    Повреждение датчика детонации. В случае такой неисправности на панели приборов должна загореться лампа неисправности двигателя. Кроме того, при выходе из строя ДД детонации детонация отсутствует ни в одном из режимов работы силового агрегата и мощность двигателя также снижается. При такой проблеме лучший вариант - восстановить целостность контактной группы в электрической цепи и установить новый датчик.

    15. Обрыв датчика кислорода

    Поломка кислородного датчика или нарушение его цепи.Для такой неисправности характерно загорание лампы «Проверьте двигатель». В этом случае первым делом необходимо проверить нагревательную спираль на целостность. Сначала измеряется сопротивление, а во-вторых, уровень напряжения на выходе. Измерение можно проводить даже без разрыва цепи - достаточно проткнуть изоляцию иглами.

    Для устранения неисправности стоит отремонтировать кислородный датчик, восстановив качество проводки и прочистив все отверстия, через которые засасывается воздух.В крайнем случае необходимо заменить сам кислородный датчик.

    16. Сброс давления в выхлопной системе

    Диагностировать такую ​​проблему несложно - достаточно осмотреть основные элементы при работе двигателя на средних оборотах. Для решения проблемы необходимо заменить прокладку выпускного коллектора и растянуть все сальники.

    17. Отказ ЭБУ

    Отказ электронного блока управления (ЭБУ). Несмотря на свою надежность, ЭБУ тоже может выйти из строя (иногда его программное обеспечение просто теряется).Чтобы убедиться, что он исправен (выход из строя ЭБУ), необходимо проверить напряжение на самом блоке (нормальный параметр около 12 Вольт) или заменить его на заведомо исправный блок. Если блок управления неисправен, возможно, его необходимо заменить. В некоторых случаях достаточно поменять только проводку.

    18. Нарушение регулировки зазора в приводе клапана

    Соответствие параметров можно проверить только с помощью специальных щупов.Если зазоры не правильные (написано в руководстве), то необходимо произвести регулировку.

    19. Деформация или поломка пружин клапана

    В этом случае придется снять головку блока цилиндров и измерить длину пружин под нагрузкой и в свободном состоянии. Если были обнаружены сломанные или деформированные пружины, то их нужно заменить.

    20. Изношены кулачки распределительного вала

    Здесь будет достаточно визуального осмотра (после снятия необходимых элементов) и замены.распредвал при необходимости.

    21. Нарушение фаз газораспределения

    В таких случаях необходимо проверить совпадение меток на распредвале и коленвале. Если есть «неуравновешенность», то достаточно установить правильное положение по специальным отметкам.

    22. Низкий уровень компрессии в цилиндрах

    Низкий уровень компрессии во всех или некоторых цилиндрах. Причины включают вероятное повреждение клапана или износ, поломку или заедание поршневых колец.Чтобы убедиться в подозрениях или опровергнуть их, достаточно произвести необходимые замеры. Если подозрение подтвердилось, то необходимо отремонтировать силовой агрегат - поменять кольца, поршни или отремонтировать цилиндры.

    Вывод

    Вышесказанное - лишь часть неисправностей, из-за которых падает мощность двигателя. Но в большинстве случаев этого достаточно, чтобы диагностировать проблему, устранить ее и вернуть столь необходимую тягу вашему «железному коню».

    /4
    Наихудшее

    Хозяин автомобиля субъективно воспринимает эту неисправность, отмечая, что машина стала «ленивой», что двигатель «не тянет».«Но как точнее определить истинное состояние двигателя по параметрам мощности? Для этого существуют вполне конкретные оценки. Максимальная скорость, развиваемая автомобилем, и время, за которое он проехал 1 км пути при трогании с места с переключением передач. при интенсивном разгоне.Испытания для определения этих параметров автомобиля проводятся на горизонтальном прямолинейном участке дороги с ровным и твердым покрытием в сухую погоду при отсутствии ветра. Участок дороги должен быть достаточной длины, при этом должна быть обеспечена полная безопасность движения (отсутствие встречного транспорта, пешеходов и т. д.). Все измерения производятся при движении в двух противоположных направлениях с закрытыми дверными стеклами и вентиляционным люком в передней части кузова. ходовой части транспортного средства (схождение и развал передних колес, давление в шинах, регулировка тормозных механизмов) и проверьте путь свободного качения (выбег) транспортного средства от постоянной скорости 50 км / ч до полной остановки. Для этого разгоните автомобиль на прямой передаче до 50 км / ч и двигайтесь с этой скоростью до заданного ориентира на дороге, например, индикатора километра: при проезде ориентира необходимо быстро выключить сцепление и сразу же двигаться. рычаг переключения передач в нейтральное положение.

    Этот тест проводится при движении в двух противоположных направлениях, и берется среднее значение, которое должно быть не менее 420 м. Часто в процессе доведения автомобиля до нормы биения он становится «резвым», так как причиной его плохих динамических качеств был не двигатель, а неправильно настроенный схождение или «тугие» тормоза. .

    Итак, что и где проверить, нет ли реакции дроссельной заслонки двигателя (двигатель не тянет).

    1. Проверьте все датчики.

    1.1. ДМРВ - датчик массового расхода воздуха. При неисправности смесь может быть слишком богатой (съест много бензина) или бедной - будет вяло разгоняться. Как попробовать проверить датчик самостоятельно: Если разгон вялый, отсоединить разъем датчика, запустить. Обороты холостого хода сразу станут высокими, загорится лампа «проверьте двигатель / проверьте двигатель». Попробуй прокатиться в таком режиме. Если ускорение станет намного лучше (разницу вы почувствуете сразу), значит датчик явно неисправен.Можно попробовать аккуратно смыть керазином, но это ненадолго.

    Поскольку датчик дорогой, заменяйте воздушный фильтр каждые 5000 км, чтобы продлить срок его службы. больше всего они не любят падающий на них песок или пыль.

    1.2. ДПКВ - Датчик положения коленчатого вала. Проблемы с ним возникают редко, иногда достаточно очистить поверхность между шестерней и датчиком от грязи.

    1.3. Р.Х.Х. - регулятор холостого хода. Представляет собой шаговый двигатель ... Иногда он заклинивает и является причиной того, что двигатель не запускается в холодную погоду.В случае неисправности обороты холостого хода могут «зависнуть», сильно плавать или двигатель заглохнет после отпускания дроссельной заслонки. Явным признаком неработающего датчика может быть работающий двигатель, но только при нажатой педали акселератора. После выпуска глохнет.

    1,4 ДПДЗ - датчик положения дроссельной заслонки. Стоит на оси дроссельной заслонки. При выходе из строя педаль газа начинает работать нелинейно, обороты скачут, «замирают». Рекомендую установить датчик приближения (чуть дороже) и надолго забыть о его замене.

    1,5 DC - датчик кислорода. Следит за составом смеси. Он стоит перед катализаторами (в новых машинах их два - еще один после катализатора). Неисправный датчик также является причиной «тупого» разгона. Саму исправность определить сложно. Обычно контроллер прошивается, чтобы исключить этот датчик из работы.

    2. Проверить топливный насос.

    Работу бензонасоса обычно оценивают по давлению в рампе форсунок.Нормальным считается давление чуть больше 3 атмосфер. Лучше зайти и попробовать диагностику. Работа с бензином на горячем двигателе по-прежнему наиболее опасна. Стоит проверить сетку бензонасоса. Часто он забивается и сразу падает давление в рейке, что может существенно сказаться на разгоне.

    Плохие свечи - частые возгорания. Это заметно по тому, как плавают обороты на x.x. Рекомендую поставить проверенные (берите в престижных магазинах, чтобы не нарваться на подделку) - NGK и Brisk.По опыту эксплуатации - надежные лидеры в тестах «За рулем».

    4. Низкая компрессия в цилиндрах.

    Может из-за перегоревшего клапана (или сразу нескольких). Резко падает мощность двигателя и заметно увеличивается расход бензина. На 8-клапанных моторах клапаны необходимо периодически регулировать. Если этого не делать долгое время, то это может вызвать низкую компрессию и ее разброс по цилиндрам.

    Часто новички и не только водители интересуются, почему машина не разгоняется и не тянет.Обычно эта проблема связана с двигателем. При первых признаках неисправности желательно провести детальную диагностику двигателя. Это избавит вас от долгих поисков поломки. Почти все может вызвать недостаток тяги в двигателе.

    Владельцы новых автомобилей часто сталкиваются с этим. Если диагностика не поможет выявить проблему, то придется немного помучиться. Это подключено и перейдет на пробег в 5000 км. Чаще всего это встречается в моделях комплектующих, собираемых в Китае.

    Износ деталей

    Почему машина не разгоняется и не тянет? В некоторых случаях это может быть связано с высоким уровнем износа двигателя. Обычно встречается на довольно старых машинах. Чаще всего страдают кольца, в связи с этим падает компрессия. Поэтому первое, что нужно сделать при снижении мощности - это. Если даже в одном цилиндре показатель меньше 11, то двигатель придется ремонтировать.

    Иногда снижение мощности двигателя свидетельствует о наличии нагара на клапанах; это можно проверить только сняв головку блока цилиндров.Косвенные признаки:
    • Изменение соотношения газов в выхлопе;
    • Горение на панели "чек".
    Для его устранения придется очистить клапан. После этой работы все должно нормализоваться.

    Фильтры

    Часто машина дергает из-за нехватки топлива ... На каждой машине есть топливные фильтры ... Их обычно два. Фильтр грубой очистки находится либо в топливном насосе, либо встроен в шланг. Перед форсункой установлен фильтр тонкой доочистки.Если какой-либо из этих очистителей засорен, топливо не может поступать в форсунку в достаточной степени. Это, в свою очередь, резко снижает эффективность транспортного средства.


    Летом часто забивается воздушный фильтр ... При этом смесь плохо обогащается кислородом, и топливо сгорает не полностью. В результате снова происходит потеря мощности. Чтобы избежать подобных проблем, необходимо своевременно заменять фильтрующие элементы.

    Зажигание

    Современный двигатель довольно чувствителен к работе зажигания.Неправильный зазор между электродами свечи зажигания может вызвать отказ двигателя. И соответственно к снижению мощности двигателя. Поэтому всегда. Также нужно проверить их работоспособность на специальном стенде. Это также можно сделать простым, но надежным способом.

    Для этого откручивается свеча. На него надевается высоковольтный провод, после чего двигатель заводится стартером. Качество искры определяется визуально. Он должен быть бело-голубым. Если искра красного или желтого цвета, это считается плохим качеством.Вам следует поискать проблему в системе зажигания. Скорее всего, это будет причиной потери мощности.

    Диагностика

    Для более точного определения проблемы желательно. Эта процедура поможет выявить проблемы с датчиком и питанием. Для этого вам понадобится ноутбук со специальной программой. Расшифровав показания, нужно приступить к поиску неисправности. Чаще всего причины могут быть следующие:

    • Неисправность датчика положения коленвала.При этой неисправности обычно горит «Проверьте двигатель». Снижение мощности происходит из-за несовпадения импульса, подаваемого на блок управления двигателем, и реального положения коленчатого вала. В результате происходит неполное сгорание топлива, и КПД мотора снижается;
    • ... Эта проблема также может влиять на мощность двигателя;
    • Причина может быть в. В этом случае чек не загорится. Поэтому в любом случае проводить диагностику необходимо.

    Вывод ... Как видите, причин проблемы достаточно, и все они достаточно разные. Навскидку сказать, почему машина не разгоняется и тянет, не сможет ни один авторемонтник. В любом случае придется провести тщательную и кропотливую работу по диагностике и поиску причин неисправности.

    В жизни автомобилистов часто возникает ситуация, когда при выезде на дорогу и попытке ускорения замечается, что двигатель не тянет.

    То есть динамика разгона очень "вялая", машина нехотя набирает скорость, и кажется, что что-то ее держит.

    Эта проблема может возникнуть практически с любым автомобилем - отечественной или иномаркой, бензиновым и дизельным, с системой питания карбюратора и инжектором.

    Часто падение тяги сопровождается дополнительными симптомами - при работающем двигателе слышны посторонние звуки, двигатель может заглохнуть в одном из режимов (обычно на холостом ходу), обороты коленчатого вала нестабильны и « плавать".

    Но это не всегда так, бывает, что агрегат ведет себя отлично по всем параметрам, но не развивает мощность.

    Основные причины

    Причин данного явления множество, и в большинстве случаев они связаны с неисправностью систем и механизмов силовой установки.

    Некоторые из них тривиальны и очень просты в ремонте, другие требуют довольно серьезного ремонта.

    Основная проблема с тем, что двигатель не тянет, связана не с поиском неисправности, а с ее поиском.

    В некоторых случаях очень сложно определить причину уменьшения тягового усилия и приходится разбирать практически весь двигатель.

    Поэтому постараемся выделить основные причины, по которым машина очень «вяло» разгоняется.

    Так как двигатели на разных автомобилях имеют свои конструктивные особенности, то мы рассмотрим это на конкретных моделях.

    Падение мощности на карбюраторном двигателе ВАЗ

    Для начала возьмем автомобили ВАЗ с карбюраторной системой питания и 8-клапанным ремнем ГРМ - ВАЗ-2109, ВАЗ-2110, ВАЗ-2114, ВАЗ-2115.

    То же установлено на этих автомобилях. power point, следовательно, причины идентичны.

    Пройдемся по составным частям темы, из-за неисправности которых может произойти падение динамики.

    В целом основная причина того, что двигатель не тянет, это изменение процессов в камерах сгорания - несоответствие пропорций топливовоздушной смеси, процесса сгорания, наполнения цилиндров и отвода выхлопных газов не происходит. как и ожидалось.

    Система питания

    Очень часто падение тяги происходит из-за системы питания. Конструктивно карбюраторная топливная система, применяемая на автомобилях от ВАЗ-2109 до ВАЗ-2115, очень проста и практически полностью механическая, поэтому выявить причину не составляет особого труда.

    Падение мощности может происходить из-за:


    Помимо элементов, отвечающих за подачу топлива, падение мощности также происходит из-за сильного загрязнения элемента воздушного фильтра.

    Система зажигания

    Эта система также принимает участие в горении смеси, а это значит, что сбой в ее работе может повлиять на мощность.

    В карбюраторных двигателях ВАЗ-2110 и др. Снижение тяги может происходить из-за:

    • Неисправности свечей зажигания или изменения их теплового зазора;
    • Чрезмерный износ контактов и центрального электрода распределителя;
    • Обрыв напряжения в высоковольтных проводах;
    • Нарушения угла опережения зажигания.

    Нарушения в системе питания и зажигания чаще всего становятся причинами падения мощности, поэтому проверку для выявления причины следует начинать именно с них.

    Если работа этих систем не вызывает подозрений, следует провести диагностику других компонентов двигателя.

    Выхлопная система, ГРМ и КШМ

    Потеря тяги также может произойти из-за выхлопной системы, хотя на карбюраторных двигателях проблемы с ней возникают редко.

    Основная причина этого - снижение производительности из-за больших отложений нагара в глушителе.Из-за этого выхлопные газы, не успевая выйти из цилиндров, «душат» двигатель.

    Причинами падения тяги также часто являются газораспределительный механизм и цилиндро-поршневая группа.

    Здесь снижение мощности связано с:

    • нарушениями теплового зазора клапанов;
    • Сильный нагар на дисках клапанов, седлах или их прожог;
    • Возникновение колец;
    • Предельный износ ЦПГ;
    • Пробой прокладки ГБЦ.

    В целом проблемы с ГРМ и ЦПГ вызывают падение мощности у любых двигателей - карбюраторных, инжекторных, дизельных. Поэтому мы не будем упоминать эти механизмы в будущем.

    Инжекторные двигатели ВАЗ

    В инжекторных двигателях ВАЗ-2110, 2112, 2114, 2115, как с 8-ми, так и с 16-ти клапанным газораспределением, выявить причину снижения мощности сложнее из-за более сложной конструкции двигателя. основные системы.

    Система питания

    Любая форсунка состоит из механического привода и электронного управления, и оба они могут вызвать проблемы, которые приведут к падению мощности.

    Рассмотрим первую механическую часть ... Здесь на тягу могут влиять:

    • Сильное засорение сетчатого фильтра бензонасоса;
    • Падение производительности топливного насоса из-за износа;
    • Загрязненный фильтр тонкой очистки;
    • Неисправность регулятора давления в топливной рампе;
    • Форсунки засорены;
    • Загрязненный топливный фильтр;
    • Утечка воздуха в коллекторе.

    В целом практически каждый элемент исполнительной части форсунки может быть виновником снижения динамики.

    Примерно такая же ситуация и с электронной составляющей.

    Работа двигателя с форсункой контролируется электронным блоком, который постоянно контролирует параметры с помощью датчиков, установленных в различных системах.

    Количество этих следящих элементов велико и выход из строя любого из них приводит к тому, что ЭБУ неправильно оценивает показатели, на основании которых он управляет исполнительной частью.

    Из-за этого нарушаются показания ДПКВ, в результате нарушается работа системы зажигания, что приводит к падению тяги.

    В двигателях с впрыском система отвода выхлопных газов чаще создает эту проблему, чем на карбюраторных автомобилях, и все из-за использования.

    Ячейки элемента имеют небольшое поперечное сечение, поэтому довольно быстро забиваются, что приводит к тому, что выхлопные газы «давят» двигатель.

    Основные причины с двигателями других автомобилей

    Итак, на автомобиле Mitsubishi Lancer 9 чаще всего проблема возникает с выхлопной системой. В этом автомобиле используется двойной катализатор, который относительно быстро забивается нагаром.

    Поэтому многие владельцы данной машины при падении мощности рекомендуют в первую очередь обратить внимание именно на эту систему.

    Но в двигателях ЗМЗ-406 и 405, которыми комплектуются автомобили ГАЗель и Волга, падение мощности часто связано с:

    • неисправностями катушек зажигания;
    • Потери в высоковольтных проводах;
    • Свечи битые;
    • Поломка датчиков (в первую очередь - ДПКВ).

    Но не стоит забывать и о других элементах систем питания, зажигания, а также ГРМ и ЦПГ, упомянутых выше.

    Для автомобилей Ford Focus в целом проблемы с потерей тяги возникают из-за неисправностей датчиков, а также элементов системы питания - особенно топливного модуля, который включает в себя и топливный насос, и фильтр, объединенные в единый состав.

    Примерно то же самое можно сказать и о таком автомобиле, как Renault Megane. В этой машине падение мощности может произойти из-за:

    • Износ крышки распределителя;
    • Неисправные свечи зажигания и высоковольтные провода;
    • Слабая проходимость выхлопной системы;
    • Изношенный топливный насос и грязные фильтрующие элементы;
    • Датчики форсунок повреждены.

    А вообще, в первую очередь следует искать причину в системах питания и зажигания, а уже потом переходить к ГРМ и ЦПГ.

    Если дизель не тянет

    Снижение тяги может возникнуть в дизельных двигателях ... Если рассматривать старые автомобили, у которых системы питания полностью механические, то наиболее частой причиной является разгерметизация системы.

    Двигатель

    Троит на холостом ходу ВАЗ 2107. Как быть, если двигатель троит? Диагностирую и ремонтирую! Причины обрезки двигателя

    Если вы находитесь в компании своих друзей, вы скажете вам, что ваш двигатель отсутствует (от Ang.Отсутствует), возможно, вы не ошибетесь или просто посмотрите на вас «квадратными» глазами ... Другое дело, если вы соблюдаете то, что двигатель троит или у вас не работает один из цилиндров, и в таком случае большое количество различных версий и предположений, взятых из личного опыта, а также советов, которые в этом случае необходимо делать. Можно в принципе прислушаться к советам друзей, там ничего не скачет, но я бы тоже порекомендовал прислушаться к мнению специалистов по этому поводу.В сегодняшней статье я расскажу о том, что такое триммер двигателя и откуда он взят, вы узнаете о причинах этого неприятного явления, а также о способах устранения этой неисправности. Вооружившись необходимой мне информацией, я решил позвать автомобилистов на один популярный в нашем городе город, чтобы узнать, написана ли правда в бланках различных «знатоков» и стоит ли им верить. Проще говоря, решил спросить, почему троит к двигателю тех, кто имеет прямое отношение.

    Начнем с того, почему двигатель троит, а не «два» или не «четвертый», например: -)

    Дело в том, что совсем недавно у большинства двигателей было четыре цилиндра, примерно сколько могло быть шести, восьми или двенадцати, наверное, 30 лет назад никто не поверил бы, ну да ладно ... В общем, когда один из четырех цилиндров перестал работать, то рабочих цилиндров осталось только три, и звук мотора серьезно изменился. Это явление и получило название двигателя троит, то есть мотор работает на трех цилиндрах с характерным звуковым сопровождением.Спустя год изменилось количество цилиндров, а термин Троит остался прежним.

    Как понять какой двигатель троит?

    Лично мне кажется, что перепутать обшивку ни от чего невозможно. Этот звук сразу услышит, ваша машина вроде как на замену и начинает работать как старый Запорожец с какой-то вибрацией и "натянуто". Вместо равномерной синхронной работы четырех цилиндров слышно какое-то прерывистое освещение. Словом, это сложно описать.При этом из глушителя будет слышна «бомбежка», а не даже шипение.

    Что чревато обрезкой?

    В первую очередь, пропадешь как не крутой, и на трех цилиндрах двигатель не пойдет как на четырех. Здесь вроде бы все ясно. Второй признак того, что двигатель троит - это вибрация и характерная «дрожь», которая исходит из моторного отсека. Третья характерная особенность мотора Троит - это перерасход топлива и запах бензина в выхлопных газах.Как вы думаете, все? Нет, это, как говорится, только цветы, если неисправность не обнаружить и не устранить - вас ждут большие неприятности.

    Объясню почему. Когда один цилиндр не работает, в нем не происходит сгорания топливной смеси, а значит, она вся накапливается в цилиндре, затем разбавляется и смешивание с маслом идет в картер. Чем больше топлива попадет в картер, тем больше будет разбавлено масло, его вязкие и смазывающие свойства со временем полностью исчезнут.В результате вы получите значительное снижение компрессии, критический износ поршня и колец, которые будут сушиться в камере сгорания без капли смазки, создавая объемность и стирая стенки цилиндров. Наконец - капитальный ремонт двигателя просто неизбежен.

    Причины, по которым двигатель может работать рысью

    Как вы уже знаете троттери, но проблема все же заключается в какой-то неисправности, которая становится причиной прекращения работы цилиндра. К сожалению, причин, по которым двигатель троить может несколько, это серьезно затрудняет поиск.

    Итак, вашему вниманию наиболее частые причины обрезки двигателя

    В первую очередь начнем с неработающего цилиндра:

    1. Достаем двигатель и открываем капот.
    2. Послушайте двигатель и постарайтесь его запомнить.
    3. Далее по очереди вытаскиваем высоковольтные провода. При вытаскивании провода работа двигателя должна измениться, так как свеча перестает получать ток, значит, перестает работать цилиндр. Если работа двигателя не изменилась, значит, имеется нерабочий цилиндр.Ищите, пока не узнаете, какой из цилиндров не работает.
    4. Теперь необходимо выяснить, в цилиндре ли искра или нет, это позволит понять причину, а также указать направление, в котором нужно двигаться.

    Теперь нужно проверить свечи зажигания для этого

    1. Берем свечу и откручиваем свечу в нерабочем цилиндре.
    2. Оцените состояние электрода по следующим критериям:

    Нагар или лазание на свечу мешает ее нормальной работе, искра слабая, либо ее нет совсем.Очистив свечу или только временно решив проблему, нужно посмотреть в корень неисправности и продолжить поиск причины, по которой свеча в таком состоянии.

    Проверка свечи на искру

    Чтобы узнать истинную причину, нужно проверить искру. Для этого открутите свечу, затем протяните высоковольтный провод и приложите свечу с металлическим кожухом к двигателю, электрод свечи не должен касаться двигателя. Далее вам понадобится помощник, он должен покрутить стартер, а пока необходимо следить за свечой.Если при вращении стартера искра не появляется - снимите ее с массы на 1 см и попробуйте еще раз.

    Слабая искра или полное ее отсутствие говорит о следующем:

    1. Проблемы с высоковольтными проводами - высокое сопротивление или обрыв. С помощью мультиметра при большом сопротивлении замените их.
    2. Неисправность катушки зажигания - проверьте, нужно ли ее менять.
    3. Неисправен ЭБУ. При необходимости сделайте диагностику, сделайте замену.
    4. Вышел из строя ДПКВ (датчик положения коленвала).Как правило, при такой поломке появляется ошибка, которую выдает бортовой компьютер, так же про нее можно узнать компьютерную диагностику. Если нужно .
    5. Обнаружено несколько зубов. Проверьте, как стоит ремень, если его положение нарушено, снимите ремень и отрегулируйте положение валов и шестерен по меткам.

    Если искра есть и свечи в полном порядке - ищите причины, по которым двигатель может троить: проблемы с компрессией, неисправные кольца, забитые форсунки, плохая подгонка клапанов или необходимость регулировки клапанов.

    Иногда бывают случаи, когда двигатель троит только "на холоде" или "на горячем"

    В этом случае причиной чаще всего становятся клапаны, возможно они увеличиваются. Необходимо проводить каждые 20 тыс. Км. Суть этой проблемы в том, что, скорее всего, клапаны имеют большие зазоры, но после прогрева двигателя они становятся меньше и двигатель не троит. То же и «на горячем» - при холодном двигателе клапан в норме и двигатель работает плавно, однако после прогрева он не регулируется клапаном, в результате цилиндр перестает работать и двигатель заводится на высоком уровне.

    На этом я закончу, надеюсь, моя статья была вам полезна и вы нашли причину паровозных войск. Если нет, обратитесь за помощью к своим специалистам. Если вы с радостью знаете другие причины для паровозных войск, вы их выслушаете, для этого воспользуйтесь формой комментариев.

    & nbsp.

    Звук, возникающий при трогании двигателя, вряд ли с чем-то спутать. Прерывистое постукивание идет по станку, что свидетельствует о наличии проблем с работой двигателя.

    Трой вызывает снижение мощности двигателя, что ни о чем хорошем не свидетельствует. Автомобиль тратит больше ресурсов, а в выхлопных газах резкий запах бензина. Если вовремя не найти и не устранить причину дифферента, может потребоваться капитальный ремонт или полная замена.Двигатель необходим, чтобы затратить значительное количество времени и внушительную сумму денег.

    Наверняка многие автолюбители и владельцы 2107 недоумевали, почему Троит двигатель ВАЗ 2107 карбюраторный на морозе? Этот эффект возникает из-за обратимого возврата процессов износа составляющего энергоблока.Однако далеко не все знают, где найти настоящие причины поломки, а тем более устранить существенную проблему.

    В следующем материале мы постараемся максимально подробно ответить на вопрос, почему происходит тримминг двигателя.

    Почему Троит Двигатель на ВАЗ 2107 - Причины

    Троя не возникает ниоткуда, на его появление в любом случае есть причина.

    С чего начать поиск дефектов при обнаружении эффекта дифферента двигателя:

    • Поршневая группа.
    • Система зажигания.
    • Воздушный фильтр.
    • Клапаны и их производные.
    • Карбюратор.

    После того, как читатели статьи узнали о возможных местах поломки, необходимо рассказать о том, как избавиться от проблемы и избежать последствий.

    Способы устранения возможных неисправностей

    Для устранения эффекта дифферента двигателя автомобилисту понадобятся теоретические знания устройства силового агрегата, а также умелые руки.Чтобы справиться с большинством задач, также пригодится минимальный инструментальный набор. Ниже приведены элементы двигателя, в которых может быть скрыта причина дифферента, а также способы устранения неполадок в проблемных местах автомобиля.

    Причиной обрезки двигателя может служить износ поршня и / или поршневых колец, которые с большой вероятностью повреждают стенки цилиндров, из-за чего появляются царапины. Выход один - полный ремонт деталей. Естественно, это не приятная и довольно затратная по деньгам процедура.

    Владельцу автомобиля предстоит провести полный анализ головки блока цилиндров и поддона. После нужно вытащить поршни и внимательно осмотреть цилиндрические стенки - если видно, что они развиваются, нужна полная разборка двигателя, а после, если износ действительно не мал, расходы на необходимый ремонт.

    Составные части головки блока цилиндров могут вызвать перегрузку двигателя. Особенно это касается клапанов, которые уже давно эксплуатируются и имеют значительную степень износа, из-за чего не плотно прилегают к седлу.В результате выхлопные газы возвращаются в камеру сгорания, в результате чего двигатель задыхается.

    Для устранения этой проблемы необходима замена клапана. Для выполнения этой процедуры вам потребуется полный анализ головы. Чаще всего выходят из строя направляющие втулки и их нужно будет заменить, следовательно, требуется полный ремонт блока блока.

    Для устранения проблемы, скорее всего, потребуется замена всех компонентов головки блока.

    Уточнение причины начинается с регулирования подачи топливно-воздушной смеси. Все регулируется качественными винтами и количеством, что соответствует рекомендациям инструкции, которая идет в комплекте при покупке двигателя ВАЗ 2107.

    Если регулировка не принесла результата, нужно будет полностью пройти через карбюратор. В двигателе ВАЗ 2107 установлена ​​установка элементов впрыска - Вебер и ДААЗ. Эта пара карбюраторов имеет однотипную конструкцию, а потому ремкомплекты к элементам идентичны.Все для ремонта карбюратора покупается в специализированных магазинах автозапчастей или на авторынке.

    При выходе из строя какой-либо из частей, составляющих систему зажигания, также может возникнуть эффект дифферента двигателя. Говоря простым языком, на одном или нескольких из нескольких цилиндров у меня искра не горит. Для устранения проблемы проводится диагностика системы зажигания.

    Свечи зажигания нужно открутить от головки блока и внимательно изучить их. Сначала проведите визуальный осмотр на наличие трещин, грязи или других проблем.Далее сделайте четкие контактные контакты, используя тесты или подставку для свечей.

    При поломке необходимо произвести замену с предварительной регулировкой нужного расстояния между контактами.

    Есть еще старый метод проверки свечей. Необходимо открутить цилиндрическую свечу и подключить ее к проводу с высоким напряжением, а после, прислонив свечу к корпусу станка, выполнить прокрутку зажигания.

    Если говорить о высоковольтных проводах, то их диагностика заканчивается проверкой по величине сопротивления.Подходящий провод характеризуется показателем 5 Ом. Если показатель не соответствует этому номеру (выше или нише нормы), необходимо будет заменить провод. Лучше заменить весь комплект проводов с предварительной проверкой их на работоспособность.

    Проверить катушку зажигания можно с помощью мультиметра. Таким образом можно проверить наличие контакта и значение индикатора сопротивления. Если проблема обнаружена, необходимо заменить.

    Неисправность Причина неисправности Метод разработки
    Двигатель с трудом смеется или вообще не заводится 1.Влажность и загрязнение катушки и свечей зажигания, поэтому искровой искры нет.

    2. Ослабление крепления или окисление контактов разъемов.

    3. Мокрые свечи зажигания (после частых попыток запустить двигатель).

    4. Ослаблено крепление датчика частоты вращения, слишком длинное к маховику двигателя.

    5. Неисправен датчик частоты вращения; Провод имеет контакт с «массой» и обрыв.

    6. Неисправна катушка зажигания.

    7. Неисправен силовой модуль или блок управления.

    1. Сухой или чистый и. При необходимости обработайте аэрозоль для свечей зажигания.

    2. Проверить и при необходимости заменить.

    3. Снимите и просушите свечи зажигания.

    4. Закрепите датчик скорости вращения.

    5. Заменить в СТО; Проверьте провод или замените его.

    6. Заменить катушку зажигания.

    7. Проверить в автомастерской и при необходимости заменить.

    Проблемы с подачей топлива

    К подаче топлива относятся топливный фильтр и подающие трубки.Загрязнение одной из этих деталей конструкции может стать причиной подачи небольшого количества топлива в карбюратор.
    Для устранения проблемы потребуется замена топливного фильтра или тщательная очистка трубок.

    Есть еще один элемент системы, влияющий на нормальный расход топлива - топливный насос. При его поломке требуется ремонт или замена. После всех ремонтных процедур топливо начнет стабильно подавать, из-за чего эффект дифферента полностью пропадает.

    Двигатель

    Трой также может появиться из-за загрязнения воздушного фильтра В результате двигатель не получает нормального количества воздуха для образования топливовоздушной смеси.

    Для экономии двигателя потребуется замена сменного фильтрующего элемента. Особых сложностей в этой процедуре нет. Для его реализации необходимо просто открыть капот, затем открутить гайки крепления крышки корпуса и вытащить изношенный фильтр. Замените его новым элементом смены и верните все детали на прежнее место.

    Выход: В поиске причины неисправности двигателя ВАЗ 2107 нет ничего сложного. Начать диагностику неисправности лучше всего с элементов, участвующих в создании топливовоздушной смеси. Затем проверьте зажигание и проверку топливной системы. Ну и наконец, самая опасная причина проблем может заметить полный ремонт мотора из-за износа элементов поршневой группы и головки блока.

    Приветствую вас друзья на сайте ремонта автомобилей ВАЗ своими руками.Двигатель внутреннего сгорания - это один из самых важных и сложных производителей автомобиля.

    Если время от времени не производить его обслуживание, замену неисправных элементов и ремонт, то со временем могут возникнуть самые разные проблемы - снижение мощности, повышение «аппетита» двигателя, появление посторонних шум и вибрация.

    В то же время одной из самых частых проблем является «троекция» двигателя. Как показывает практика, такая проблема может возникнуть на любой машине, как отечественной, так и иномарке.

    Главное для водителя - уметь своевременно диагностировать, найти неисправность и произвести качественный ремонт.

    Основные признаки, почему троит двигатель

    Если известны основные симптомы неисправности, то выявить факт наличия троя не составит труда. Их несколько:

    1. Показаны неисправности двигателя. холостой ход, а также сильные вибрации, которые передаются по кабине водителю и пассажиру.

    Такие проявления сложно с чем-то спутать, поэтому можно смело говорить об отказе одного из цилиндров.

    Проблема только в том, что такие симптомы появляются слишком поздно, когда один из «виновников» окончательно отказал.

    2. Электроды на одной из свечей черные, покрытые наигаром или пропиткой. Большинство автомобилистов производят замену «неисправной» свече, не задумываясь о причинах. Так нельзя.

    Потемнение свечи может быть признаком более серьезных проблем двигателя, требующих оперативного решения.

    3. Изменяет звук выхлопа.Как правило, при триммировании двигателя возникающие звуки буквально сотрясают машину. Опытный автомобилист сразу замечает, что с машиной что-то не так.

    4. Увеличивает "Прожорливые" автомобили. Причин такого явления множество, поэтому желательно провести полную диагностику силового узла.

    5. У машины портится динамика. Особенно это заметно в момент набора скорости, на небольших поворотах.

    Но опять же, такая проблема может указывать на ряд других неисправностей.Следовательно, вам нужна комплексная диагностика.

    При этом колебания могут быть как очень значительными (от 900 до 1500 оборотов в минуту), так и незначительными.

    7. При установке скорости и нормальном движении на любой из передач возникают неприятные рывки.

    Причины и неисправности дифферента двигателя

    Допустим, у вас действительно троит двигатель. Деактивировать в такой ситуации невозможно. С одной стороны поездка на излишне «прожорливое» и постоянно дергающееся авто удовольствия не принесет, а с другой - появляется вероятность выхода из строя остальных узлов (эффект домино).

    Следовательно, необходимо четко знать, почему мотор троит, и что с этим делать.

    Выделим основные причины, по которым двигатель троит:

    • Зажигание.
    • Вакуумный усилитель.
    • Свеча зажигания.
    • Провода высокого напряжения.
    • Воздушный фильтр.
    • Кольца поршневые.
    • Клапаны регулировки и их упражнения.
    • Неисправность трима.

    Диагностировать такую ​​проблему можно по прохождению одного из часов, появлению звуков «похлопывания», «подпрыгивания» мотора.

    Прослушайте работу силового узла. Если двигатель троит на холостом ходу, а после начала движения и набора оборотов проблема исчезает, значит, причина в более раннем зажигании.

    В этом случае достаточно внести простые корректировки, которые потребуют как минимум времени.

    2. Повреждение в системе вакуумного усилителя тормозной системы (нарушение герметичности клапана или диафрагмы). Такая неисправность может привести к появлению воздуха в системе.

    В результате топливно-воздушная смесь становится «беднее» и не воспламеняется в двигателе. Достаточно одного-двух «проходов» на свечу из мокрого и переставшего выполнять свои функции.

    Появление такой проблемы проявляется на всех режимах - двигатель троит на горячем, холодном и на холостом ходу.

    3. Выход из строя свечи зажигания. Как правило, почти в половине случаев эта причина является основной при появлении обрезки.

    Для исключения проблемы желательно время от времени осматривать свечи, производить их чистку и замену (с учетом сроков, прописанных в инструкции по эксплуатации автомобиля).При этом желательно поменять весь комплект.

    4. Время высоковольтных проводов - явление очень редкое, но бывает. Что творится? Если есть повреждение одной из проводок, искра пробьет ваш путь раньше и не достигнет вашей свечи.

    Диагностировать проблему проще всего в темноте. Достаньте двигатель и внимательно осмотрите участок от распределительной катушки до свечей.

    Появление яркой искры в промежутке между катушкой и двигателем свидетельствует об испытании изоляции высоковольтного провода или конденсатора.

    В качестве временной меры подойдет утепление поврежденного участка (можно использовать обычный изолятор). В дальнейшем «виновника» лучше заменить.

    5. Загрязнение воздушного фильтра. Бывают случаи, когда автомобилисты меняют моторное масло, но забывают установить новый воздушный фильтр.

    В результате машина начинает «задыхаться». Топливно-воздушная смесь не обогащается необходимым объемом кислорода, и свечи при подаче топлива в двигатель просто «переливаются» бензином.

    Устранить эту проблему не составит труда - достаточно установить новый фильтр.

    6. Деформация поршневых колец - явление очень редкое. Чтобы исключить эту проблему из «Агенды», обязательно сжимайте компрессию в цилиндрах двигателя.

    7. Нарушение регулировки клапанов (их зазор) сказывается на работе всего узла. В результате время от времени один из цилиндров не получает свою порцию топливовоздушной смеси.

    Неисправность проявляется на всех режимах - двигатель троит на холоде, на холостом ходу и даже в движении.Еще одна вероятная причина - износ рокеров.

    Чтобы решить проблему, вам необходимо снять GBC и настроить клапаны в соответствии с инструкциями руководства по эксплуатации.

    8. Время перемещения также может вызвать появление узла питания.

    Слабым местом этого устройства являются втулки, валы и подшипники поворотной пластины, которые имеют свойство изнашиваться.

    Для исправления ситуации необходимо отремонтировать или заменить траверсу.

    5. След клапана или поршня - серьезная проблема, которую можно устранить только ремонтом двигателя.

    Внимание! Определить движение двигателя не так просто, так как причин много, в статье описаны основные, но конечно не все, многое зависит от типа двигателя (инжектор, карбюратор).

    Сложность заключается еще и в том, что диагностировать проблему очень сложно - необходимо разобрать силовой узел и осмотреть клапаны и поршни лично.

    Но учтите, что выполнять эти работы желательно после проверки (если они не принесли результата) и только при наличии соответствующего опыта.

    Помните, что от вашего ухода зависит срок службы автомобиля и его стабильная работа.

    Необходимо знать, троит ли двигатель - это всего лишь симптом, указывающий на возникновение проблемы в одном из механизмов двигателя.

    Ваша задача - найти неисправность и устранить ее. Чем быстрее вы это сделаете, тем меньше будет негативных последствий для двигателя и дешевле обойдется ремонт. Удачи на дорогах и конечно же без поломок.

    Троит инжекторный двигатель ВАЗ 2107: причины и методы лечения

    Семейство автомобилей ВАЗ, особенно инжекторные двигатели Старое поколение славится тем, что возникает такая неисправность как триммер.Почему возникает такой эффект и как с ним бороться, рассмотрим в этой статье.

    Причины неисправности

    Автолюбители задаются вопросом: почему Троит Двигатель ВАЗ 2107 Форсунка ? Многие владельцы инжекторных ВАЗ 2107 сталкивались с тем, что двигатель заводил трой . Эта неисправность характерна для всего семейства Lada Motors. Каковы причины такого эффекта и где искать неисправность:

    • Топливный насос и фильтр.
    • Сопло.
    • Свечи зажигания I. высоковольтные провода .
    • Воздушный фильтр.
    • Дроссель.
    • Клапан.
    • ЭБУ и датчики.

    Способы решения

    Когда причины завихрения двигателя ВАЗ 2107 впрыскивающего типа определены, можно переходить непосредственно к анализу вариантов устранения проблемы. Прежде чем продолжить, необходимо знать, какие конструктивные особенности нужно знать мотору.

    Но, мотор 2107 настолько прост, что даже самый неопытный автомобилист поймет, в чем дело. Итак, рассмотрим как снять ДВС войск ВАЗ 2107 , форсунка .

    Похожие новости

    Топливный насос и фильтр

    Первое место, где нужно найти причины, начинается с подачи топлива. Для начала стоит проверить топливный насос на работоспособность и отсутствие нарушений в работе. Если на этом элементе нет видимых признаков повреждений, рекомендуется его разобрать и проверить.

    Многие опытные автомобилисты советуют после бензонасоса приступить к замене фильтрующего элемента топлива, так как именно топливо может быть плохим для форсунок. Топливный фильтр, согласно сервисной документации, необходимо менять каждые 30-35 тысяч км пробега.

    Форсунки

    Следующим местом, где можно найти неисправность, становятся непосредственно сами форсунки. Они могут быть забиты из-за использования некачественного топлива или неисправны в условиях эксплуатации, проще говоря - изношены.

    Элементы проверяются на специальном стенде, который не только производит диагностику состояния, но и проводит элементы. Если есть поврежденный или изношенный элемент, лучше заменить его новым элементом.

    ВАЗ

    2107 Форсунка - Лечение троат и проход зажигания

    Диагностика выявила засорение четвертой форсунки бензина, сбой и множественные проходы всего.

    Троит Двигатель ВАЗ 2107 Нашол

    Троит Двигатель .

    Похожие новости

    Свечи зажигания и высоковольтные провода

    Потеря искры также может привести к нарушению работы двигателя. Следующим узлом, который необходимо исследовать, становится зажигание. В первую очередь рекомендуется провести диагностику свечей зажигания. Для этого нужно снять их с головки блока и визуально осмотреть наличие трещин. Далее рекомендуется очистить свечи от скопившейся грязи.

    Стоит отметить, что необходимо обращать внимание на состояние контактов свечей.Если они в масле или нагреваются, то проблема не только в двигателе.

    Следующим этапом диагностики становится транск звонка с использованием мультиметра и разрыва. В большинстве случаев такая диагностика показывает, что свечи не пригодны для дальнейшего использования, и их необходимо заменить.

    Еще один элемент системы зажигания, непосредственно влияющий на воспламенение топливовоздушной смеси - это высоковольтные провода. От их состояния тоже будет зависеть, и мотор будет работать экономично.Поэтому рекомендуется осмотреть их на предмет повреждений, а также вызвать мультиметр.

    Воздушный фильтр

    Клапан

    Усиливающие клапаны могут вызвать подстройку двигателя, поскольку между седлом и выпускным клапаном образуется ползунок, через который выхлопные газы возвращаются в камеру сгорания, чем баланс в воздухе -топливная смесь нарушена.

    Для диагностики узла нужно демонтировать головку блока. Часто уже прогоревшие клапаны являются первым признаком износа поршневой группы, и соответственно все приводит к капремонту.

    ЭБУ и датчики

    Последним местом, где стоит искать неисправность, становятся датчики. Итак, выход одного или нескольких измерительных элементов может быть вызван действием подстройки. Следовательно, автомобилисту придется проверять их вручную, потому что электронный блок управления не всегда распознает, что датчик вышел из строя.

    Электронный блок управления двигателем также может вызвать дифферент. Накопленные ошибки или повреждения программного обеспечения нарушат работу всей системы.Для диагностики и устранения неисправности рекомендуется обратиться к специалистам.

    Многие автолюбители и владельцы ВАЗ 2107 задались вопросом - а почему двигатель троит? Эффект возникает из-за процессов необратимого износа детали силового агрегата. Но не все знают, где искать непосредственно причины неисправности, а тем более способы устранения проблемы.

    Причины обрезки двигателя

    Почему Троит двигатель ВАЗ 2107 карбюраторный и каковы причины проявления этого эффекта? В этой статье мы постараемся максимально подробно разобраться в этом вопросе. В отличие от инжектора, причины будут разными, но будут взаимосвязаны и похожи.

    Итак, разберемся, где искать проблемы подстройки двигателя карбюратор Ваз 2107:

    • Поршневая группа.
    • Клапаны и их производные.
    • Карбюратор.
    • Система зажигания.
    • Воздушный фильтр.

    Теперь, когда разобраны все места возникновения неисправности, стоит перейти непосредственно к методам устранения.

    Способы решения

    Для устранения эффекта триммирования двигателя автомобилисту потребуются некоторые структурные знания силового агрегата, а также руки, растущие из нужного места. Чтобы устранить большинство причин, которые вам нужны, также необходимо установить минимальный набор инструментов.

    Поршневая группа

    Поршневая группа - страшная мечта любого автомобилиста. Причиной движения двигателя может быть износ поршней и маслосцепных колец, которые помимо этого могут повредить стенки цилиндров, образуя на них царапины и проседания.В этом случае единственный выход - капитальный ремонт. Конечно, процедура эта не из приятных и не из дешевых.

    Автомобилисту придется демонтировать ГБЦ и поддон. Далее необходимо снять поршни и осмотреть стенки цилиндров, если она развернута, двигатель необходимо демонтировать полностью, и в зависимости от степени повреждений и износа необходим ремонт. С другой стороны, если это не имеет смысла, вы можете заменить force агрегат по контракту, что может быть дешевле капитального ремонта.

    Головка блока

    Головка блока цилиндров, а точнее ее составные части, может стать второй причиной, по которой произойдет обрезка. В первую очередь это касается клапанов, которые уже изношены и легко прилегают к седлу. В результате выхлопные газы возвращаются к камню сгорания, и двигатель начинает задыхаться.

    Для решения проблемы необходимо заменить градуировочный и впускной клапаны. Для процедуры придется полностью разобрать голову.Как показывает практика, направляющие втулки клапана также сломаны и нуждаются в замене, в связи с чем поплавки, что требует капитального ремонта GBC.

    Таким образом, в процессе работы потребуется замена не только клапанов, но и седел, и направляющих втулок клапанов. Для того, чтобы убрать зазор между клапаном и седлом, вторым пройти процесс махлости.

    Карбюратор

    Другой причиной обрезки двигателя является карбюратор. Причина возникновения начинается с того, что стоит отрегулировать подачу топливовоздушной смеси.Регулировка осуществляется при помощи качественных и количественных винтов, согласно инструкции, написанной в разделе «Ремонт двигателя и эксплуатация двигателя ВАЗ 2107».

    Если действия по регулировке не помогли, то следующим шагом будет набить сам карбюратор. В двигателях Ваз 2107 установлены элементы впрыска - Вебер и ДААЗ (озон). Эти два карбюратора имеют одинаковую конструкцию, поэтому ремкомплекты им идентичны. Ремкомплекты карбюратора можно приобрести в магазинах или на автомобильном рынке.

    Система зажигания

    Еще одной причиной проблемы с двигателем войск становится система зажигания, то есть при выходе из здания катушки или высоковольтные провода. Если проще говорить, то на одном или нескольких цилиндрах искры нет. Для решения проблемы нужно провести диагностические операции.

    Свечи зажигания необходимо открутить от головки блока и провести исследование. Сначала детали осматриваются визуально на предмет трещин, загрязнений и других дефектов. Вызвать контакты свечей зажигания можно тестером или специальной подставкой для свечей.

    Если товар неисправен, необходимо поменять его на новый, предварительно отрегулировав зазоры между контактами. Также есть способ стариков проверить свечи. Для этого свечу скручивают из цилиндра и подключают к высоковольтному проводу, а затем, прислонив свечу к кузову автомобиля, включают зажигание.

    Что касается высоковольтных проводов, то их диагностика заканчивается вызовом сопротивления. Рабочий и подходящий провод имеет показатель 5 Ом.Если показатель выше или ниже, его необходимо изменить. Обычно рекомендуется заменять провода полным комплектом, предварительно проверив их на работоспособность.

    Проверка катушки зажигания производится мультиметром на наличие контакта, а также сопротивления. В случае выявления неисправности необходимо поменять ее на новый товар.

    Подача топлива

    В группу деталей подачи топлива должны входить топливный фильтр и трубки подачи топлива.Итак, повреждение этих деталей конструкции может привести к недостаточному количеству топлива, которое подается в карбюратор. Для устранения проблемы необходимо заменить топливный фильтр и прочистить форсунки системы подачи топлива.

    Еще один элемент топливной системы, влияющий на стабильную подачу топливной смеси - АЗС. При выходе из системы нужно отремонтировать или заменить элемент. После проведения ремонтных работ необходимо стабилизировать подачу топлива, что нарушит действие дифферента.

    Воздушный фильтр

    Еще одной причиной появления в моторном отсеке карбюратора ВАЗ 2107 становится воздушный фильтр, который происходит из-за загрязнения, не пропускающего достаточное количество воздуха для образования топливовоздушной смеси. Чтобы вылечить двигатель, необходимо заменить сменный фильтрующий элемент.

    Заменить элемент воздушного фильтра довольно просто. Для этого нужно попасть в пространство подкастов, то есть приоткрыть капот. Затем продвигаем 3 гайки крепления крышки корпуса и снимаем старый фильтр.Установите новый элемент переключения передач и соберите все обратно.

    Выход

    Определите причины - почему троить двигатель ВАЗ 2107 карбюраторного типа достаточно просто. Стенды стартовой диагностики с элементами, участвующими в образовании топливовоздушной смеси. Затем проверьте систему зажигания и подачи топлива. Ну и последнее, но самой страшной причиной может быть капитальный ремонт двигателя, из-за износа поршневой группы и головки блока.

    (PDF) Устойчивость к бобовым мастревирусу на основе РНК-интерференции

    Инокуляция растений CpCDPKV

    Twenty-five T

    1

    трансгенных N.benthamiana содержат

    конструкцию РНКи, полученную в результате самоопыления.

    растений T

    или

    были подвергнуты агроинфильтрации конструкцией, обеспечивающей инфекционность

    CpCDPKV, как описано ранее [19]. Десять

    нетрансгенных растений того же возраста (возрастом 4 недели) были пропитаны

    в качестве контроля. Все агро-инфильтрованные растения

    периодически наблюдались на предмет появления симптомов.

    Присутствие вируса в трансгенных и нетрансгенных

    растениях было обнаружено с помощью гибридизации по Саузерну и ПЦР в реальном времени.

    Гибридизация по Саузерну для обнаружения вирусной ДНК

    Тотальную ДНК выделяли из инокулированных растений [39]

    и 500 нг ДНК растворяли в 1% агарозном геле в

    0,5 × ТАЕ буфере. Блоттинг проводили, как описано ранее

    [40]. Блот гибридизовали с ДНК-зондом, меченным биотином-

    (1000 п.н.) (приготовленным с использованием набора для мечения ДНК Biotin DecaLa-

    bel ™ [Fermentas]), содержащим части

    генов, кодирующих белок движения (MP) и белок оболочки

    . (CP).Гибридизацию и обнаружение ДНК проводили

    в соответствии с рекомендациями производителя.

    Количественная оценка вирусной ДНК в растениях с помощью ПЦР в реальном времени

    Количественная ПЦР (кПЦР) была проведена для количественной

    фиксации вирусной ДНК в трансгенных растениях (показывающих устойчивость

    к CpCDPKV) и нетрансгенных растениях

    ( показывающий инфекцию для CpCDPKV) с использованием зеленого красителя SYBER

    (IQ SYBER Green supermix, BIO-RAD USA)

    , как описано ранее [41].Основанная на нуклеотидной последовательности

    CpCDPKV (AM849097), пара праймеров QF

    (5'TAAAAGGCGCACTAATGGGTAGACCGTAGA3'-

    , охватывающая координаты нуклеотида 102-131) и QR

    - tGAC0003

    - tGAC0003, охватывающая координаты 9GACCUCC,

    -

    -CCC, охватывающая координаты

    9000CATACCC (координаты 5'GAC0003

    - 251-233) был разработан для амплификации продукта

    длиной 150 п.н., специфичного для CpCDPKV. Молодые листья

    образцов были собраны с инокулированных растений при 17

    точек на дюйм, и количественная ПЦР была проведена в трех повторностях по

    со стандартами и контролями.

    Дополнительный материал

    Дополнительный файл 1: Анализ кривой плавления продуктов, произведенных

    во время анализа qPCR. На графике показан график зависимости отрицательной производной флуоресценции

    от температуры (° C) для каждой пробирки для амплификации

    . Виден единственный пик, указывающий на усиление одного продукта

    .

    Благодарности

    NN была поддержана стипендией Комиссии высшего образования

    (HEC), правительства Пакистана.RWB работает в HEC по программе «Наем иностранных преподавателей

    ». Эта работа была частично поддержана исследовательским грантом

    Международного центра биотехнологии и генной инженерии

    (ICGEB), Триест, Италия.

    Вклад авторов

    Н.Н., ИА проводили эксперименты. Авторы исследования - RWB и SM. Рукопись написали NN,

    IA, RWB и SM. Все авторы прочитали и утвердили окончательную рукопись

    .

    Конкурирующие интересы

    Авторы заявляют, что у них нет конкурирующих интересов.

    Получено: 15 марта 2011 г. Принято: 2 ноября 2011 г.

    Опубликовано: 2 ноября 2011 г.

    Ссылки

    1. Баулкомб, округ Колумбия. Наука 2000, 290: 1108.

    2. Бродерсен П., Воиннет О: Разнообразие путей подавления РНК в

    растениях. Trends Genet 2006, 22: 268-280.

    3. Бернштейн Э., Кауди А.А., Хаммонд С.М., Хэннон Г.Дж .: Роль бидентатной рибонуклеазы

    на этапе инициации РНК-интерференции. Nature 2001,

    409: 363-366.

    4. Hammond SM, Bernstein E, Beach D, Hannon GJ: РНК-направленная нуклеаза

    опосредует посттранскрипционное молчание генов в клетках Drosophila

    . Nature 2000, 404: 293-296.

    5. Vaucheret H, Fagard M: сайленсинг транскрипционных генов в растениях: мишени,

    индукторов и регуляторов

    . Trends Genet 2001, 17: 29-35.

    6. Waterhouse P, Graham MW, Wang M-B: Устойчивость к вирусу и молчание гена

    в растениях можно индуцировать одновременной экспрессией смысловой

    и антисмысловой РНК.Proc Natl Acad Sci USA 1998, 95: 13959-13964.

    7. Смит Н.А., С.П. С., Ван М.Б., Стаутжесдейк П.А., Грин А.Г., Уотерхаус PM:

    Полное молчание с помощью сплайсированных интронами шпилечных РНК. Nature 2000, 407: 319-320.

    8. Уэсли С.В., Хеллиуэлл К., Смит Н.А., Ван М.Б., Роуз Д., Лю К., Гудинг П.С.,

    Сингх С.П., Эбботт Д., Стаутджесдейк и др.: Конструкции для эффективного,

    эффективного и высокопроизводительного гена. молчание в растениях. Завод J 2001,

    27: 581-590.

    9.Моффат А.С.: Геминивирусы представляют собой серьезную угрозу для сельскохозяйственных культур. Science 1999,

    286: 1835.

    10. Боултон М.И.: Геминивирусы: основные угрозы мировому сельскому хозяйству. Ann Appl

    Biol 2003, 142: 143.

    11. Мансур С., Бриддон Р.В., Зафар Ю., Стэнли Дж .: Комплексы геминивирусных заболеваний:

    возникающая угроза. Trends Plant Sci 2003, 8: 128-134.

    12. Стэнли Дж., Бисаро Д.М., Бриддон Р.В., Браун Дж. К., Фауке С.М., Харрисон Б.Д.,

    Рыбицки Е.П., Стенджер Д.К .: Geminiviridae.В Virus Taxonomy, VIIIth Report of

    the ICTV. Под редакцией: Fauquet CM, Mayo MA, Maniloff J, Desselberger U, Ball

    LA. Лондон: Elsevier / Academic Press; 2005: 301-326.

    13. Lucioli A, Noris E, Brunetti A, Tavazza R, Ruzza V, Castillo AG, Bejarano ER,

    Accotto GP, Tavazza M: Вирус желтого скручивания листьев томата Сардиния, полученный из Rep

    , устойчивость к гомологичным и гетерологичным геминивирусам происходит с помощью

    различных механизмов и преодолевается, если активируется опосредованное вирусом сайленсинг трансгена

    .J Virol 2003, 77: 6785-6798.

    14. Chellappan P, Vanitharani R, Fauquet CM: Накопление короткой интерферирующей РНК

    коррелирует с восстановлением хозяина у хозяев, инфицированных ДНК-вирусом,

    и подавление гена нацелено на специфические вирусные последовательности. J Virol 2004,

    78: 7465-7477.

    15. Mette MF, Aufsatz W., van der Winden J, Matzke MA, Matzke AJM:

    Транскрипционное молчание и метилирование промотора, запускаемое двухцепочечной РНК

    . EMBO J 2000, 19: 5194-5201.

    16. Пуггин М., Шивапрасад П.В., Велутхамби К., Хон Т.: Нацеливание РНКи на ДНК вируса

    в растениях. Nat Biotechnol 2003, 21: 131-132.

    17. Моррис Б.А.М, Ричардсон К.А., Хейли А., Жан X, Томас Дж. Э .: Нуклеотидная последовательность

    инфекционного клонированного компонента ДНК карликового вируса желтого табака

    обнаруживает признаки геминивирусов, заражающих

    однодольных растений. Virology 1992, 187: 633-642.

    18. Лю Л., ван Тондер Т., Питерсен Дж., Дэвис Дж. У., Стэнли Дж.: Молекулярная характеристика

    геминивируса подгруппы I из бобовых растений в Южной

    Африке.J Gen Virol 1997, 78: 2113-2117.

    19. Нахид Н., Амин I, Мансур С., Рыбицки Е.П., ван дер Уолт Э., Бриддон Р.У .: В Пакистане встречаются два двудольных мастревируса

    (семейство Geminiviridae).

    Arch Virol 2008, 153: 1441-1451.

    20. Томас Дж., Парри Дж., Швингхамер М., Данн Э .: Два новых мастревируса

    из нута (Cicer arietinum) в Австралии. Arch Virol 2010,

    155: 1777-1788.

    Нахид и др., Virology Journal 2011, 8: 499

    http: // www.virologyj.com/content/8/1/499

    Страница 7 из 8

    Коды ошибок nissan x trail. Диагностика и расшифровка кодов ошибок на Nissan

    1. Выключите зажигание (выключите двигатель) после всех прогревов не менее чем на 10 секунд.

    2. Убедившись, что педаль газа отпущена, включите зажигание (ключ находится в положении ON) , не запускайте двигатель и подождите 3 секунды.

    3. В течение 5 секунд быстро нажмите (до упора!) и отпустите педаль газа 5 раз.

    4. Через 7 секунд нажмите до конца и удерживайте педаль акселератора, пока желтый индикатор CHECK ENGINE не начнет мигать (? 10 секунд) *.

    6. Запустить двигатель **

    • ) мигание лампы - переход в режим диагностики. Чтобы прочитать коды самодиагностики, отпустите педаль газа во время мигания. После этого читаем коды. Если их несколько, то они подсвечиваются последовательно. Если все в порядке, то лампа мигнет 40 раз одинаково и с одинаковыми интервалами - 0000
      • ) после запуска двигателя можно выполнить проверку кислородного датчика... Порядок действий следующий: после прогрева двигателя выключить всех потребителей, увеличить обороты до 2000 и удерживать 2 минуты. После этого убедитесь, что при работе на 2000 об / мин индикатор проверки мигает более 5 раз в течение 10 секунд.
        • ) Чтобы сбросить коды ошибок, после их считывания нажмите и удерживайте педаль газа в течение нескольких секунд, затем запустите двигатель. Это не устранение самих неисправностей! Это всего лишь сброс ошибки.После включения двигателя он, скорее всего, появится и снова там запишется.

    Чтобы значительно упростить процедуру поиска причины неисправности в автомобиле Nissan, необходимо провести диагностику автомобиля ... Полученные коды ошибок Nissan позволят точно определить возможные неисправности в работе машины.

    [Скрыть]

    Диагностика Nissan на наличие ошибок

    Процедура диагностики двигателей и других систем автомобиля на Qashqai, Pathfinder и др. Может выполняться двумя способами - компьютерным тестированием и самодиагностикой.Первый вариант более точен, но для его реализации потребуется дополнительное оборудование в виде сканера и ПК.

    Методы самодиагностики

    В автомобилях Nissan Primera P12, Almera и многих других процедура выполняется так:

    1. Ключ вставляется в замок и прокручивается до положения включения зажигания, затем приходится ждать три секунд.
    2. В течение пяти секунд необходимо 5 раз нажать и отпустить педаль газа.
    3. Пройдет 7 секунд.Затем педаль еще раз утопают в пол, ее нужно удерживать десять секунд.
    4. Если действия выполнены правильно, то на приборной панели автомобиля замигает индикатор Check Engine.
    5. Затем педаль газа отпускается.

    Пользователь Олег Олег рассказал о процедуре самодиагностики методом «педалирования» и считывания полученных кодов неисправностей.

    Мигание значка на «приборке» X-Trail, Qashqai и других моделей демонстрирует комбинации в четырехзначном виде.Первый символ всегда отображается длинными вспышками, за ним следуют остальные цифры. Они демонстрируются коротким миганием. Между выводом символов делается двухсекундный перерыв. Количество миганий соответствует значению цифры в комбинации ошибок, за исключением 0. Последнее обозначается десятью миганиями.

    Если имеется несколько кодов неисправности на X-Trail T30, Primer и других моделях, они будут отображаться последовательно. После диагностики в машине отключается зажигание.

    Пример чтения кода неисправности 2826:

    • 2 - два долгих мигания индикатора Check с последующей двухсекундной паузой;
    • 8 - восемь кратковременных вспышек с перерывом в 1 сек;
    • 2 - два коротких мигания с паузой;
    • 6 - шесть коротких вспышек с интервалом 1 сек.

    Пауза между миганием индикатора во время самодиагностики Nissan всегда составляет 2 секунды.

    В моделях из примера P11 более ранних годов выпуска процедура самотестирования выполняется иначе:

    1. Щелкают по клавишам для сброса суточного пробега и настройки параметров часов.Эти кнопки необходимо нажимать и удерживать.
    2. Ключ используется для включения зажигания. После этого ключи можно отпускать.
    3. Начнется процедура самотестирования. При активации стрелки датчиков на панели приборов (оборотов, температуры двигателя и т. Д.) Одновременно начнут перемещаться от наименьшего значения к наибольшему.
    4. Чтобы отобразить код ошибки на дисплее одометра, необходимо нажать одну из кнопок. Первое нажатие отображает версию программного обеспечения компьютера, а следующее - саму комбинацию неисправностей.

    Но этот вариант не подходит для выявления проблем, связанных с работой двигателя в Р11, для этого выполняются другие действия:

    1. Зажигание включается поворотом ключа в замке.
    2. Тогда вам нужно получить доступ к блоку безопасности. Он находится в районе педали сцепления в салоне автомобиля. Необходимо демонтировать защитную пластиковую крышку устройства.
    3. Блок диагностики находится в корпусе с блоком.С помощью канцелярской скрепки нужно замкнуть контакты IGN и SNK. Если речь идет о предстайлинговом варианте Примеров, то перемычка устанавливается между крайними контактными элементами, установленными в верхнем ряду. В рестайлинговых машинах Р11 нужно замкнуть контакты в нижнем ряду. В частности, речь идет о крайних левом и правом элементах.
    4. После закрытия, через две секунды, перемычка снимается.
    5. Контрольная лампочка на приборной панели начнет мигать, по вспышкам можно определить комбинацию неисправности.Длинные мигания указывают на первый символ кода, а короткие мигания - на второй. Число в комбинации соответствует количеству вспышек. В рестайлинговых версиях Примера P11 коды будут отображаться в четырехзначном виде.
    6. На завершающем этапе отключается зажигание.

    В автомобилях Nissan Wingroad, оборудованных правым рулем и педалью акселератора с механическим приводом, процедура диагностики выполняется путем замыкания контактов.Только схема подключения в этих моделях автомобилей несколько отличается. Сам выход находится в салоне автомобиля вне зависимости от года выпуска.

    Схема диагностических колодок разъема Nissan Wingroad OBD2 в автомобилях Nissan

    Компьютерная диагностика

    Данная процедура выполняется с помощью ПК или ноутбука, на котором сначала необходимо установить программу для проверки:

    1. Требуется диагностический адаптер. С его помощью нужно соединить компьютер и блок.Обычно он расположен на центральной консоли автомобиля слева от рулевого колеса. Возможна установка в блок предохранителей.
    2. Зажигание включено, на некоторых моделях автомобилей в этом нет необходимости. Надо уточнить в сервисной книжке.
    3. Программа проверки запускается на компьютере. Если программное обеспечение требует, то вы можете выбрать конкретные системы, подлежащие диагностике. Начинается процесс тестирования компонентов машины.
    4. На экране ПК или ноутбука будут отображаться коды ошибок, которые присутствуют в работе автомобиля.Все они подлежат расшифровке и удалению.

    Пользователь Вячеслав Кравченко подробно рассказал о процедуре компьютерной диагностики автомобиля Nissan.

    Как расшифровать ошибки?

    Коды неисправностей в Nissan pathfinder, Tiida и других моделях будут выдаваться в разных комбинациях в зависимости от типа проверки. Во время самодиагностики автовладелец должен считывать двухзначные коды ошибок. При тестировании на компьютере проблемные комбинации будут четырехзначными.

    Коды самодиагностики

    Расшифровка кодов ошибок Nissan представлена ​​в этой таблице.

    .
    Неисправность
    11 Модуль микропроцессора получает недопустимый сигнал от контроллера вращения коленчатого вала. Если датчик неисправен, могут возникнуть проблемы с запуском двигателя.
    12 Неисправность регулятора воздуха. При его неисправности могут быть нарушены пропорции для создания топливовоздушной смеси, которая образуется в цилиндрах двигателя.Это приведет к нестабильной работе ДВС. Требуется проверить сам датчик, а также электрическую цепь, к которой он подключен
    13 Блок управления получает недопустимый сигнал от блока питания терморегулятора ... Если датчик исправен, то проблема может заключаться в перегреве двигателя. Рекомендуется провести детальную проверку устройства, а также его разъемов и проводки.
    14 Модуль микропроцессора получает неверный сигнал от регулятора скорости машины.Спидометр приборной панели может отображать неверные данные. Необходимо проверить само устройство, расположенное на коробке передач, а также целостность его проводки
    21 Неправильный импульс от контроллера катушки зажигания. В случае неисправности двигатель машины может работать нестабильно.
    22 Модуль микропроцессора устранил поврежденные провода управления топливным насосом. Если цепь разомкнута, двигатель не запустится.Иногда такая ошибка является следствием перегорания предохранительного элемента, отвечающего за топливный насос.
    23 Неправильный сигнал от регулятора положения дроссельной заслонки. Требуется детальная проверка переключателя холостого хода
    25 Блок микропроцессора зафиксировал неисправности в работе принудительного увеличения скорости ХХ или его электрической цепи
    31 Неправильная работа модуля EFI или проводки управления кондиционером
    32 Блок двигателя сообщает о неисправности цепей управления клапаном рециркуляции ОГ.Проблема может быть вызвана самим устройством
    33 Неправильный сигнал, поступающий от кислородного контроллера. Требуется детальная диагностика устройства. Если он неисправен, двигатель будет работать с ошибками.
    34 Модуль микропроцессора сообщил о неверном сигнале, поступающем от регулятора детонации. Проверка устройства и контактов на его разъеме обязательна
    35 Блок управления получает неверный импульс от регулятора температуры выхлопных газов.Необходимо провести диагностику датчика
    41 Обнаружена неисправность в работе регулятора температуры воздуха или его электрической цепи
    42, 43 Модуль микропроцессора сообщает о сбоях в работе регулятора положения дроссельной заслонки или его электрической цепи. Необходимо тщательно протестировать работоспособность датчика
    44 Сервисное сообщение о правильной работе модуля EFI
    45 Блок управления сообщает о неисправности форсунки.Может быть проблема в самом микропроцессоре устройства
    51 Также сообщает о неисправностях в работе форсунок или их проводки
    54 Модуль микропроцессора сигнализирует о неисправности в диагностике проводки, через которую подключен блок управления АКПП ... Проблема актуальна только для автомобилей с АКПП.
    55 Этот код сообщает об отсутствии неисправностей в автомобиле.

    Пользователь Роман Федоров на примере автомобиля Nissan Sunny рассказал о диагностике с помощью педали и устранении неисправностей.

    Комбинации ошибок системы впрыска

    В таблице представлена ​​расшифровка кодов ошибок системы впрыска.

    Проблема Описание
    P0171-P0175 Зафиксированы сбои в работе силового агрегата. В частности, были допущены ошибки в его цилиндрах при формировании топливовоздушной смеси.Иногда на Nissan Primera P12 эти комбинации указывают на сбой в работе кислородных регуляторов или массового расхода воздуха.
    P0200 Модуль микропроцессора сообщил о неверном сигнале, исходящем от одной из форсунок двигателя. В первую очередь рекомендуется провести диагностику схемы этих элементов.
    P0201-P0212 Сообщается о некорректной работе форсунок в одном из 12 цилиндров агрегата. Требуется детальная диагностика устройства
    P0213, P0214 Блок управления электродвигателем обнаружил неисправность в работе первой или второй форсунок при запуске.Ремонт устройств в таких случаях обычно нецелесообразен, требуется их замена.
    P0215 Эта ошибка указывает на неисправность или неисправность запорного клапана двигателя. Необходимо более детально проверить работу устройства, при необходимости заменяется
    P0216 Модуль микропроцессора зафиксировал сбой в работе цепи регулировки угла опережения зажигания. Надо проверить проводку
    P0217 Блок управления сообщает о перегреве силового агрегата.Если эта проблема возникает во время движения, необходимо выключить двигатель и выяснить причину. Следует открыть моторный отсек, чтобы устройство могло быстрее остыть. С такой проблемой дальше идти нельзя, так как это может привести к возгоранию моторной жидкости. Его возгорание вызовет взрыв двигателя внутреннего сгорания.
    P0218 Сообщается о перегреве блока трансмиссии. Поэтому необходимо остановить двигатель и выяснить причину, по которой коробка передач не работает должным образом.Если постоянно использовать автомобиль с перегретой трансмиссией, это приведет к быстрому износу его основных узлов и узлов. В результате может выйти из строя коробка передач.
    P0219 Модуль микропроцессора сообщает о работе силового агрегата на повышенных оборотах. Необходимо определить причину проблемы
    P0243 Сообщается о неисправности или выходе из строя первого соленоида устройства турбокомпрессора
    P0244-P0246 Модуль микропроцессора зафиксировал неправильную регулировку электромагнитного элемента 1 турбонагнетателя.Это устройство может выводить неверный сигнал. Требуется диагностика электрической схемы. С помощью мультиметра проверьте проводку на наличие обрывов и отрегулируйте соленоид. При необходимости устройство подлежит замене.
    P0247-P0250 Модуль управления сообщил о неисправности второго соленоида турбонагнетателя. Электрическая схема проверена и прибор настроен
    P0230-P0233 Блок управления зарегистрировал некорректную работу первичного или вторичного контура топливного насоса.Причиной проблемы может стать появление обрывов проводки на определенном участке.
    P0234 Модуль микропроцессора сообщает о перегрузке силового агрегата. Вы хотите выяснить причину проблемы и исправить ее. Регулярная эксплуатация такого автомобиля приведет к более быстрому износу двигателя внутреннего сгорания.
    P0261-P0296 При появлении одного из кодов ошибки Nissan сообщает о неисправности в работе цилиндров двигателя:
    • от этих элементов, на модуль микропроцессора могут поступать неверные сигналы, импульсы будут увеличиваться или уменьшились по сравнению с нормализованными;
    • цилиндр мотора может быть неправильно сбалансирован.

    При этих проблемах сначала проводится диагностика проводки на предмет повреждений и обрывов. Это также требует балансировки устройства, которое не работает должным образом.

    P0300-P0312 Микропроцессорный модуль автомобиля Nissan зафиксировал нарушение порядка зажигания. Проблема может касаться одного из 12 цилиндров. Требуется детальная диагностика силового агрегата

    Канал «КВ Автосервис» подробно рассказал о причинах обедненной и обогащенной топливной смеси в цилиндрах двигателя.

    Неисправности датчиков

    Отдельную группу следует выделить проблемам, связанным с работой регуляторов и контроллеров.

    Код ошибки Описание проблемы
    P0100-P0104 Эти комбинации указывают на неисправности в датчике расхода воздуха, в частности:
    • причиной может быть повреждение электрической цепи или ее короткое замыкание;
    • повышенный или пониженный сигнал, поступающий от контроллера;
    • неправильная работа устройства, в частности нарушение регламента.

    Для определения причины требуется детальная диагностика датчика. При необходимости корректируется. Также с помощью мультиметра следует прозвонить на целостность проводку

    P0105-P0109 Модуль микропроцессора зафиксировал сбои в работе регулятора контроля давления во впускном коллекторе, в частности:
    • проблема может заключаться в неверном сигнале, поступающем с датчика, он будет увеличиваться или уменьшаться по сравнению с нормированным;
    • обрыв или короткое замыкание, требуется диагностика проводки на целостность;
    • поломка самого регулятора, в этом случае его нужно будет заменить на исправный.

    Также код ошибки P0109 может указывать на неисправности в работе регулятора уровня температуры воздуха на впуске. При такой проблеме прибор необходимо заменить.

    P0111-P0114 Одна из этих ошибок может свидетельствовать о выходе из строя регулятора температуры на впуске. Иногда проблема заключается в неправильном сигнале, поступающем от контроллера на модуль микропроцессора. В этом случае требуется детальная диагностика проводки на предмет коротких замыканий и целостности.Иногда проблему решает регулировка устройства.
    P0115-P0119 Появление этих кодов неисправностей указывает на то, что регулятор температуры охлаждающей жидкости не работает должным образом. При данной неисправности на приборной панели будут отображаться неверные значения

    Причины появления ошибок могут быть следующие:

    • выход из строя терморегулятора;
    • с устройства на модуль микропроцессора отправляется неверный импульсный сигнал, он может быть увеличен или уменьшен, данные о температуре отображаются некорректно;
    • необходимость регулировки контроллера.
    P0120-P0124 Появление этих кодов неисправностей свидетельствует о неисправности датчика положения дроссельной заслонки, в частности, речь идет о первом регуляторе. Причину следует искать в целостности проводки - она ​​может быть повреждена или замкнута на массу. Также проблема может заключаться в неправильном сигнале, поступающем от датчика на модуль микропроцессора. Иногда регулировка контроллера позволяет решить проблему.
    P0125, P0126 Ненормальный уровень сигнала, поступающего от регулятора температуры охлаждающей жидкости.Проблема может заключаться непосредственно в антифризе. Если его температура выше нормируемой, это приведет к перегреву двигателя, если ниже, то к его некачественному нагреву.
    P0178, P0179 Эти коды ошибок сообщают о недопустимом сигнале от регулятора соотношения воздух-топливо. При этих проблемах работа силового агрегата может быть некорректной, а его мощность может снизиться. Практика показывает, что автовладельцы часто сталкиваются с тройками двигателей при движении на пониженных оборотах.Этот признак - одна из предпосылок появления подобных ошибок.
    P0180-P0184 Модуль микропроцессора зафиксировал сбои в работе электрической цепи первого регулятора температуры топлива. Устройство отправляет неверный сигнал в ЭБУ или требует настройки датчика. В некоторых случаях проблему может решить замена контроллера.
    P0185-P0189 Произошла поломка второго регулятора температуры топлива в топливном баке... Требуется настроить параметры контроллера, диагностировать его электрическую схему. При необходимости заменяется датчик
    P0195-P0199 Одна из этих ошибок указывает на неисправность в регуляторе, который отвечает за контроль уровня температуры моторного масла. Блок управления может получать неверный импульсный сигнал. Иногда проблему можно решить, очистив контактные элементы на разъеме датчика или отрегулировав его. В случае неисправности контроллера прибор подлежит замене.

    Пользователь Сабыржан Абильтаев рассказал о неисправностях датчика распредвала и решении проблем в работе регулятора.

    Другие проблемы

    Проблемы, не вошедшие в предыдущие разделы, представлены в таблице.

    не получится. .
    Код Описание и рекомендации по устранению
    P1212 Модуль микропроцессора, используя эту комбинацию, сообщает о неисправностях, появившихся в работе CAN-шины автомобиля.Проблема может заключаться в исчезновении сигнала между блоком управления, а также антиблокировочной тормозной системой ЭБУ ... Требуется провести более детальную диагностику разъема и контактов, возможно засорение или окисление
    P0335 Этим кодом блок управления сообщает о сбоях в работе регулятора положения коленвала ... Возможно, причина неисправности кроется в его электрической цепи. Необходимо провести детальную диагностику датчика и проверить целостность проводки.Если действительно некорректно работает контроллер и пропадает сигнал с него, то возникнут трудности с запуском двигателя. При полном выходе из строя датчика запустить мотор
    P0340 Модуль микропроцессора сообщает о некорректной работе электрической цепи на участке линии от управляющего устройства к распределительному валу или контроллеру детонации. Практика показывает, что код ошибки 0340 редко прямо указывает на неисправность регулятора.Обычно проблема заключается в повреждении проводки или плохом контакте устройства с электрической цепью.
    P1320 Блок управления сообщает о некачественном сигнале зажигания. Причиной отказа 1320 может быть выход из строя предохранительного устройства, отвечающего за функционирование этой системы. Возможна некорректная работа контакта в проводке. Требуется диагностировать цепь на предмет повреждений
    P1111 В модуль микропроцессора поступили данные о некорректном параметре напряжения в электрической цепи, соединяющей ЭБУ и датчик температуры.Это контроллер, установленный на входе. Проблема ищется так же, как и с другими датчиками. Сначала проверяется сам контакт, проводка, при необходимости регулятор меняет
    C1143 ЭБУ двигателя сообщает о повреждении электрической цепи или коротком замыкании датчика угла поворота рулевого колеса. Необходимо произвести детальное тестирование устройства и электропроводки
    P1614 Модуль микропроцессора сообщает о неисправности усилителя антенного адаптера на блокировщике двигателя.Если иммобилайзер работает некорректно, это приведет к затруднениям при запуске двигателя внутреннего сгорания. При полном выходе из строя антенны запуск блока питания будет невозможен
    U1000, U1001 Одна из этих ошибок свидетельствует о появлении сбоев в работе системы гидроусилителя руля. Причин много, начиная от недостатка смазки в магистралях и заканчивая некорректной работой насоса. При выходе из строя гидроусилителя руля поворачивать руль будет сложнее.
    P0335 Блок управления обнаружил неисправность в регуляторе положения коленчатого вала. Двигатель машины с ошибкой 0335 не заводится или заводится с трудом. Иногда во время движения появляются рывки на малых оборотах двигателя

    Андрей Канаев на примере Nissan Tiida показал процесс чтения ошибок и их дальнейшую расшифровку для определения поломки.

    Как сбросить?

    Процедуру удаления кодов неисправностей из памяти блока управления автомобиля Nissan рекомендуется производить с помощью секундомера.

    Руководство по сбросу:

    1. В замок вставлен ключ, включается зажигание.
    2. Затем в течение пяти секунд нажмите педаль газа 5 раз, после чего ее отпустите.
    3. Вы должны подождать 7 секунд. На восьмой секунде педаль газа нажимается и удерживается в этом положении в течение 10 секунд. После этого на приборной панели автомобиля должен мигать светодиодный индикатор Check Engine.
    4. Когда лампочка погаснет, педаль газа отпущена. Вы можете оценить правильность поставленной задачи.Если индикатор моргнул четыре раза, это означает, что бортовой компьютер выдал код «0000». Соответственно, информация об ошибках была удалена из памяти микропроцессорного блока.
    5. После того, как индикатор перестал мигать, необходимо нажать на газ и удерживать педаль десять секунд. Затем выключают зажигание.

    Видео «Сброс ошибки на модели Nissan Primera»

    Пользователь Артем Кустов продемонстрировал процедуру удаления кодов неисправности в автомобиле Nissan Primera.

    В процессе эксплуатации автомобилей Nissan возможны различные неисправности в электронике, которые проявляются в виде горящей лампы. Проверьте двигатель ... В этом случае можно наблюдать изменения в поведении автомобиля. Считывание и расшифровка кодов ошибок Nissan помогает выявить неисправность.

    [Скрыть]

    Как проверить?

    Одна из основных причин для диагностики автомобиля Nissan - горящий значок Check Engine на комбинации приборов.Для считывания кодов ошибок используется либо специальный сканер, подключенный к разъему бортовой сети автомобиля, либо специальная система самодиагностики. Расшифровка кодов ошибок Nissan позволит выявить вышедший из строя блок и провести ремонт.

    На некоторых Nissan, например модели Sunny, владельцы не могут войти в режим самодиагностики. Для считывания ошибок на них используется сканер ELM, который вставляется в диагностический разъем. Данные об ошибках передаются на обычный ноутбук или смартфон.

    Auto Selection 24 RF показывает диагностику Nissan Murano на этом видео.

    Ошибки чтения в режиме самодиагностики

    Запуск режима диагностики на Nissan Example P12 происходит следующим образом:

    1. Включите зажигание и подождите 3 секунды.
    2. Нажмите и отпустите педаль газа 5 раз в течение 5 секунд.
    3. Через 7 секунд после последнего нажатия снова полностью утопить педаль газа и удерживать ее 10 секунд.
    4. Если все сделано правильно, значок Check Engine начнет мигать на комбинации приборов Nissan Primera P12.
    5. Отпустить педаль газа.
    6. Мигающий значок показывает коды ошибок в четырехзначном формате. Первая цифра кода отображается длинными вспышками, за ней следуют цифры второго символа и т. Д., Которые отображаются короткими вспышками. Между отображением цифр есть перерыв в 2 секунды. Количество миганий равно значению цифры в коде ошибки, за исключением цифры 0 - она ​​обозначается десятью миганиями. Если ошибок несколько, они будут отображаться последовательно.
    7. Ошибки можно сбросить, нажав педаль газа на 10 секунд, оставаясь в режиме диагностики. Значок Check Engine покажет код 0000.
    8. Выключите зажигание.

    Например, код ошибки 1514 (обрыв цепи в сигнале регулятора холостого хода двигателя) будет отображаться как:

    • 1 - одно долгое мигание, затем пауза почти 2 секунды.
    • 5 - пять коротких вспышек с интервалом в 1 секунду, после которых будет пауза на 2 секунды.
    • 1 - одно короткое мигание и пауза в течение 2 секунд.
    • 4 - четыре коротких мигания каждые 1 секунду.

    Аналогичным образом коды ошибок считываются на следующих моделях Nissan:

    • Tiida;
    • Almera h26 и Almera Classic;
    • Ноутбук;
    • Ixtrail;
    • Qashqai;
    • Teana;
    • Murano;
    • Навара.

    На более раннем Nissan Example P11 процедура считывания ошибок отличается:

    1. Нажмите кнопки сброса одновременно с ежедневным пробегом и настройками часов и удерживайте их.
    2. Включите зажигание и отпустите кнопки.
    3. Начнется самотестирование, при котором стрелки спидометра, тахометра и уровня топлива одновременно переместятся с минимального значения на максимальное и обратно.
    4. Код ошибки отображается на экране одометра при нажатии любой кнопки комбинации - первое нажатие показывает версию программного обеспечения, второе - непосредственно отображает коды ошибок.

    Помните, что ошибки двигателя в P11 не считываются таким образом.Для этого используется другая процедура:

    1. Включите зажигание.
    2. Откройте крышку блока предохранителей в районе левой ноги водителя.
    3. Установить перемычку в диагностический разъем между контактами IGN и CHK. На предстайлинге P11 необходимо замкнуть крайние правые контакты в верхнем ряду. На рестайлинговом P11 144 крайний левый и крайний правый контакты в нижнем ряду колодок замкнуты.
    4. Снимите перемычку через две секунды.
    5. По миганию лампы Check Engine можно определить код ошибки.Длинные вспышки соответствуют первому символу кода, короткие - второму. Количество вспышек соответствует значению символа. На рестайлинговом P11 144 коды ошибок уже будут четырехзначными.
    6. Выключить зажигание.

    На Nissan Wingroad с правым рулем, оборудованном педалью газа с механическим приводом, ошибки также отображаются при замыкании штифтов в диагностическом контакте. Разъем имеет немного другой вид.

    Замкните контакты 1 и 8

    Видео от Алексея Никитина демонстрирует самодиагностику Vingroad 1999 года с 1.Бензиновый двигатель 8 литров.

    Как правильно декодировать?

    На ранних автомобилях Nissan, например, в примере P11, ошибка, полученная от комбинации приборов, должна быть преобразована в двоичный код, который расшифровывает тип неисправности. Пример расшифровки кода ошибки Nissan 141 ниже.


    Код ошибки декодирования 141 на примере Nissan P11

    Кроме того, некоторые ошибки можно расшифровать из таблицы без перевода их в двоичный код.

    Четырехзначные коды на современных машинах можно расшифровать с помощью таблиц, которые постоянно обновляются производителем.

    Датчики

    На Murano Z50 часто встречается ошибка P1051, сигнализирующая о неисправности в первом кислородном датчике. Есть только один способ исправить ошибку - заменить датчик. Распространенная ошибка для старых автомобилей - это 0115, что указывает на неисправность датчика температуры. Эта проблема также относится к автомобилям с левым и правым рулем, таким как Nissan March.На Nissan Qashqai и других автомобилях встречается код P1147, что сопровождается небольшим увеличением расхода топлива. Эта ошибка сигнализирует о неисправности, расположенной за катализатором.

    На самом новом nissan X Trail T31 от 2014 года и новее есть ошибка датчика устойчивости C1145. При замене этого датчика нужно внимательно посмотреть, как был установлен старый, так как он функционирует только в одном положении.

    Проблемы с двигателем

    У Nissan AD часто возникают проблемы с установленным на них дизельным двигателем YD22.Коды ошибок на этом аппарате отображаются с помощью перемычки в диагностическом разъеме ... Список возможных ошибок приведен ниже.

    Коды ошибок Nissan AD, часть 1 Коды ошибок Nissan AD, часть 2

    Двигатель QR20 используется на многих автомобилях Nissan, включая Almera classic, который представляет собой код P0340. Для аналогичного двигателя на X Trail T30 типичны следующие ошибки.

    Коды ошибок QR20

    Проблемы с проводкой

    Похожая проблема - ошибка U1000, при которой автомобиль заводится, но во время движения горит символ Check Engine.Один из владельцев столкнулся с этой ошибкой на Almera N16 2002 года с механической коробкой передач после замены центрального блока управления. Причиной проблемы стало использование блока от авто с автоматической коробкой передач. На одном из Nissan teana 2011 года выпуска причиной этой ошибки стал плохой контакт проводки блока управления. В любом случае причину появления такой ошибки можно выяснить только при полной диагностике.

    На дизельном Nissan Qashqai 2009 года выпуска с двигателем 1.5-литровый дизель, ошибка C1130 наблюдалась в связке с C1131. Причина - окисленные контакты на блоке систем ESP и на датчике выхлопных газов. Редко встречается ошибка B2082, связанная с неисправностью датчиков в задней части пассажирского сиденья.

    Неисправности CAN-шины

    Одна из самых частых ошибок Nissan Note - это U1001, при этом автомобиль может не заводиться, глохнуть и не работать на холостом ходу. Такая ошибка сигнализирует о проблемах в работе CAN-шины автомобиля - нет связи между блоком управления и остальными блоками электросистемы.Причина может заключаться в повреждении проводки или выходе из строя агрегата. Точную причину может указать только квалифицированный диагност. При низком заряде аккумулятора на нескольких Nissan Micra была зафиксирована ошибка 1212, что свидетельствует об отсутствии связи между блоками ABS и TCS по шине CAN.

    Другие проблемы

    На автомобилях Nissan часто встречается ошибка подушки безопасности водителя B1049. Причиной этой проблемы на одном Nissan X Trail 2008 года был поврежденный поезд в рулевом колесе. После замены шлейфа проблема исчезла.Не откладывайте замену такой детали, так как вся система безопасности автомобиля не работает должным образом из-за неисправной подушки безопасности водителя.

    На Nissan Pathfinder R50 и R51 причиной ошибок может быть неисправность коробки передач АКПП. В этом случае требуется более тщательная диагностика с участием квалифицированного специалиста. При выходе из строя датчиков системы ABS загорается лампа неисправности системы, а в бортовом компьютере сохраняется ошибка C1046. Исправить можно заменой датчика, изредка помогает очистка от грязи.

    Рано или поздно у каждого водителя случается страшный момент - CheckEngine горит !!

    Несмотря на то, что этот индикатор предназначен именно для сигнализации о наличии проблемы, это явление воспринимается с замиранием сердца. Специально для новичков. Да, это понятно - ведь стоимость автозапчастей довольно высока и это сразу кажется ассоциативным - кончился двигатель. Конечно, мы полностью поддерживаем и рекомендуем придерживаться одного правила - «чек» горит срочно к специалисту! И самое главное - к нужному специалисту.Если у вас есть официальный диагностический сканер, специалист быстро расскажет, в чем проблема, и даже может сбросить ошибку, если она плавающая. Но если такая ситуация случилась на дороге. Как быть? Можно ехать на СТО, или вообще нужно стоять и ждать эвакуатора. А может, совсем не все так страшно? Как узнать, что светит "чек"? Вам действительно не нужно покупать дорогой диагностический сканер. Японские инженеры делают все более чем на 100%.В них почему-то предусмотрен специальный диагностический режим.

    Итак. Наши действия при указании «ПРОВЕРИТЬ». Запускаем тот же секретный режим.

    1. Заглушаем двигатель и выключаем все оборудование. (Соблюдение ПДД естественно - если нет аварийки - пусть работает).

    2. Включите зажигание (поверните ключ в положение ON, но не запускайте двигатель. При этом отпущена педаль газа!).

    3. Отсчитываем 3 секунды.

    4.В течение следующих 5 секунд быстро нажмите педаль газа до конца и полностью отпустите 5 раз. (даже если вы нажмете и отпустите педаль на 3 секунды 5 раз - общая продолжительность этого шага составляет 5 секунд.)

    5. Отсчитываем 7 секунд.

    6. Нажмите на педаль газа до конца и удерживайте ее. Контрольный индикатор двигателя не мигает.

    7. Отпустите педаль газа. И больше ничего не трогаем.

    Поздравляем! Вы запустили диагностический режим.Если что-то не получается, вся процедура начинается сначала. Пока не набьете руку - запаситесь часами с секундной стрелкой. Позже вы сможете считать в уме. И самое главное! Если не получилось с первого раза, не расстраивайтесь. Практически ни у кого не получается сделать это с первого раза) 10-20 раз для того, чтобы пощупать)

    Так вот лампочка мигает. Что это показывает? Он отображает 4-значное десятичное число. 0 - это десять миганий.

    Первая цифра мигает с более длительными интервалами.Следующие 3 числа короче.

    Пример (сначала хорошо. Ошибок нет. Все работает. Код 0000).

    Вы визуально уловили начало цикла индикации.

    Пауза.

    10 коротких миганий. Пауза (это вторая цифра 0).

    10 коротких миганий. Пауза (это третья цифра 0).

    10 коротких миганий. Пауза (это четвертая цифра 0).

    А теперь плохой пример - ошибка DPKV. (0335).

    Пауза.

    10 вспышек средней продолжительности.Пауза (это первая цифра 0).

    Вот как выглядит эта разбивка ...

    Ошибка постоянно повторяется. Режим самодиагностики зациклен.

    Для примера рассмотрим еще худший вариант - ошибку ДПКВ. (0335) и датчик давления масла насоса гидроусилителя рулевого управления (0550).

    Пауза.

    10 вспышек средней продолжительности. Пауза (это первая цифра 0).

    3 коротких мигания. Пауза (это вторая цифра 3).

    3 коротких мигания.Пауза (это третья цифра 3).

    5 коротких миганий. Пауза (это четвертая цифра 5)

    (завершилась ошибка 0335)

    Пауза.

    10 вспышек средней продолжительности. Пауза (это первая цифра 0).

    5 коротких миганий. Пауза (это вторая цифра 5).

    5 коротких миганий. Пауза (это третья цифра 5).

    10 коротких миганий. Пауза (это четвертая цифра из 0)

    (закончилась ошибка 0550)

    И так по кругу.

    Тогда все зависит от вас. Вы сами решаете, насколько серьезна выявленная ошибка. Вы цените - можно ехать дальше, или на СТО? Или лучше не уходить. Но X-Trail позволяет сделать еще одно - ноль ошибок. Здесь важно! Вы не устраняете причину. Если он был плавающим, он не появится. Если датчик действительно вышел из строя, ошибка появится после запуска двигателя. Более того, если ошибка плавает, и вы избавились от надоедливой лампочки, в глубине души ваша хитрость запомнит эту ошибку, но не скажет вам (не будет индикации), а сообщит официальный сканер.... И он это забудет, если какое-то количество старт-стоп двигателя пройдет и это не повторится.

    Итак, вы приняли решение обнулить. Затем, находясь в том же режиме диагностики, нажмите педаль газа и удерживайте ее около 10 секунд. Дисплей изменится на 0000.

    После завершения всех операций выключите зажигание. Ждем 5 секунд и заводим двигатель.

    Помните - этот функционал не панацея! Вам нужно очень серьезно отнестись к своим действиям.Лучше покажись на СТО.

    В этом режиме не отображаются механические проблемы, такие как амортизаторы или шаровые опоры. Он также может отображать ограниченный список ошибок автоматической коробки передач. А вот неисправные стоп-сигналы, например, будут доступны. В основном все ошибки сосредоточены в электрической системе автомобиля. Датчики положения вала, датчик массового расхода воздуха, дроссельная заслонка, генератор и тд. Дальше.

    В сл. статей, мы расскажем о других хитростях диагностики и адаптации режимов работы системы подушек безопасности, АКПП, настройки дроссельной заслонки и т. д.

    Удачи на дорогах и не ломайся!

    P0100 Неисправность цепи датчика расхода воздуха

    P0101 Выход сигнала датчика расхода воздуха из допустимого диапазона

    P0102 Низкий уровень выходного сигнала датчика расхода воздуха

    P0103 Высокий уровень выходного сигнала датчика расхода воздуха датчик потока

    P0105 Неисправность датчика давления воздуха

    P0106 ​​Выход сигнала датчика давления воздуха вне допустимого диапазона

    P0107 Низкий уровень выходного сигнала датчика давления воздуха

    P0108 Высокий уровень выходного сигнала воздуха датчик давления

    P0110 Неисправность датчика температуры всасываемого воздуха

    P0111 Выход сигнала датчика температуры всасываемого воздуха из допустимого диапазона

    P0112 Низкий датчик температуры всасываемого воздуха

    P0113 Высокий датчик температуры всасываемого воздуха

    P0115 Неисправность датчика температуры охлаждающей жидкости

    P0116 Выходной сигнал датчика температуры охлаждающей жидкости вне допустимого диапазона

    P0117 Low l Уровень датчика температуры охлаждающей жидкости

    P0118 Высокий уровень датчика температуры охлаждающей жидкости

    P0120 Неисправность датчика положения дроссельной заслонки «A»

    P0121 Выход сигнала датчика положения дроссельной заслонки «A» вне допустимого диапазона

    P0122 Низкий уровень выходного сигнала Датчик положения дроссельной заслонки «A»

    P0123 Высокий выходной сигнал датчика положения дроссельной заслонки «A»

    P0125 Низкая температура охлаждающей жидкости для управления по замкнутому контуру

    P0130 Датчик кислорода 1 (банк 1) неисправен

    P0131 Низкий сигнал датчика кислорода 1 (банк 1)

    P0132 Высокий сигнал датчика кислорода 1 (банк 1)

    P0133 Медленный отклик датчика кислорода 1 (банк 1) на обогащение / обеднение

    P0134 Нет активности выходного сигнала датчика кислорода 1 (банк 1)

    P0135 Неисправен датчик кислорода 1 нагревателя (банк 1)

    P0136 Неисправен датчик кислорода 2 (банк 1)

    P0137 Низкий уровень выходного сигнала датчика кислорода 2 (банк 1)

    9 0002 P0138 Высокий уровень выходного сигнала датчика кислорода 2 (банк 1)

    P0139 Медленная реакция датчика кислорода 2 (банк 1) на обогащение / обеднение

    P0140 Нет активности выходного сигнала датчика кислорода 2 ( Ряд 1)

    P0141 Датчик кислорода 2 нагревателя (ряд 1) неисправен

    P0142 Датчик кислорода 3 (ряд 1) неисправен

    P0143 Низкий уровень выходного сигнала датчика кислорода 3 (ряд 1)

    P0144 Высокий уровень выходной сигнал датчика кислорода 3 (банк 1)

    P0145 Медленный отклик датчика кислорода 3 (банк 1) на обогащение / обеднение

    P0146 Нет активности выходного сигнала датчика кислорода 3 (банк 1)

    P0147 Датчик кислорода 3 нагревателя (банк 1) неисправен

    P0150 Датчик кислорода 1 (банк 2) неисправен

    P0151 Низкий сигнал датчика кислорода 1 (банк 2)

    P0152 Высокий уровень сигнала датчика кислорода 1 (банк 2)

    P0153 Медленный отклик датчика кислорода 1 (запрет k 2) для обогащения / обеднения

    P0154 Нет активности выходного сигнала датчика кислорода 1 (банк 2)

    P0155 Датчик кислорода 1 нагревателя (банк 2) неисправен

    P0156 Датчик кислорода 2 (банк 2) неисправен

    P0157 Низкий уровень выходного сигнала датчика кислорода 2 (банк 2)

    P0158 Высокий уровень выходного сигнала датчика кислорода 2 (банк 2)

    P0159 Медленный отклик датчика кислорода 2 (банк 2) на обогащение / истощение

    P0160 Нет активности выходного сигнала датчика кислорода 2 (банк 2)

    P0161 Датчик кислорода 2 нагревателя (банк 2) неисправен

    P0162 Датчик кислорода 3 (банк 2) неисправен

    P0163 Низкий уровень выходной сигнал датчика кислорода 3 (банк 2)

    P0164 Высокий уровень выходного сигнала датчика кислорода 3 (банк 2)

    P0165 Медленный отклик датчика кислорода 3 (банк 2) на обогащение / обеднение

    P0166 Нет активности выходного сигнала o f датчик кислорода 3 (ряд 2)

    P0167 Датчик кислорода 3 нагревателя (ряд 2) неисправен

    P0171 Слишком бедная смесь (возможна утечка воздуха)

    P0172 Слишком богатая смесь

    P0173 Утечка топлива из блока цилиндров топливной системы № 2

    P0174 Смесь блока цилиндров No.2 слишком бедная

    P0175 Смесь блока цилиндров № 2 слишком богатая

    P0176 Датчик выхлопа CHx (состав топлива) неисправен

    P0177 Сигнал датчика CHx (состав топлива) вне допустимого диапазона

    P0178 Датчик низкого уровня сигнал CHx (состав топлива)

    P0179 Сигнал датчика высокого уровня CHx (состав топлива)

    P0180 Неисправность цепи датчика температуры топлива "A"

    P0181 Сигнал датчика температуры топлива "A" вне допустимого диапазона

    P0182 Низкий уровень сигнала датчика температуры топлива «A»

    P0183 Высокий уровень сигнала датчика температуры топлива «A»

    P0185 Неисправность цепи датчика температуры топлива «B»

    P0186 Сигнал датчика температуры топлива «B» вне допустимого диапазона

    P0187 Низкий уровень сигнала датчика температуры топлива «B»

    P0188 Высокий уровень сигнала датчика температуры топлива «B»

    P0190 Неисправность цепи датчика давления в топливной рампе

    P0191 Fuel rai L сигнал датчика давления вне допустимого диапазона

    P0192 Низкий сигнал датчика давления топлива в топливной рампе

    P0193 Высокий уровень сигнала датчика давления топлива в топливной рампе

    P0194 Прерывистый сигнал датчика давления топлива в топливной рампе

    P0195 Цепь датчика температуры моторного масла Неисправность

    P0196 Сигнал датчика температуры моторного масла вне допустимого диапазона

    P0197 Низкий сигнал датчика температуры моторного масла

    P0198 Высокий сигнал датчика температуры моторного масла

    P0199 Прерывистый сигнал датчика температуры моторного масла

    P0200 Неисправность форсунки Цепь управления

    P0201 Неисправность цепи управления форсункой No.1

    P0202 Неисправность цепи управления форсункой № 2

    P0203 Неисправность цепи управления форсункой № 3

    P0204 Неисправность цепи управления форсункой № 4

    P0205 Неисправность цепи управления форсункой форсунка № 5

    P0206 Неисправность цепи управления форсункой № 6

    P0207 Неисправность цепи управления форсункой № 7

    P0208 Неисправность цепи управления форсункой № 78

    P0209 Неисправность цепи управления форсункой № 9

    P0210 Неисправность цепи управления форсункой № 10

    P0211 Неисправность цепи управления форсункой № 11

    P0212 Неисправность управления цепь форсунки № 12

    P0213 Неисправность цепи управления форсункой № 1 холодного пуска

    P0214 Неисправность цепи управления форсункой № 2 холодного пуска

    P0215 Неисправность соленоида выключения двигателя

    P0216 Неисправность цепи управления опережениями впрыска

    P0217 Перегрев двигателя

    P0218 Перегрев трансмиссии

    P0219 Слишком высокая частота вращения двигателя (Engine Overspeed Condition)

    P0220 Неисправность датчика положения дроссельной заслонки «B»

    P0221 Сигнал датчика положения дроссельной заслонки «вне диапазона»

    P0222 Низкий сигнал датчика положения дроссельной заслонки «B»

    P0223 Высокий сигнал положения дроссельной заслонки n датчик «B»

    P0224 Прерывистый уровень сигнала датчика положения дроссельной заслонки «B»

    P0225 Неисправность датчика положения дроссельной заслонки «C»

    P0226 Сигнал датчика положения дроссельной заслонки вне диапазона «C»

    P0227 Низкий уровень сигнала дроссельной заслонки датчик положения «C»

    P0228 Высокий уровень сигнала датчика положения дроссельной заслонки «C»

    P0229 Прерывистый уровень сигнала датчика положения дроссельной заслонки «C»

    P0230 Неисправность цепи управления первичным топливным насосом (управление реле топливного насоса)

    P0231 Постоянный низкий уровень вторичного контура топливного насоса

    P0232 Постоянный высокий уровень вторичного контура топливного насоса

    P0233 Неустойчивый уровень вторичного контура топливного насоса

    P0235 Неисправность цепи датчика давления наддува «A»

    P0236 Сигнал от датчик турбины «A» вне допустимого диапазона

    P0237 Низкий уровень сигнала датчика турбины «A»

    P0238 Высокий сигнал датчика t датчик мочи «A»

    P0239 Неисправность цепи датчика давления турбокомпрессора «B»

    P0240 Сигнал датчика «B» турбины вне допустимого диапазона

    P0241 Низкий уровень сигнала датчика «B» турбины

    P0242 Высокий сигнал от датчика турбины «B»

    P0243 Неисправность соленоида заслонки выхлопных газов турбины «A»

    P0244 Сигнал соленоида заслонки выхлопных газов турбины «A» вне доп.диапазон

    P0245 Соленоид заслонки выхлопных газов турбины «A» всегда открыт

    P0246 Соленоид заслонки выхлопных газов турбины «A» всегда закрыт

    49 ..

    Nissan x-trail T31. Бензин (топливо) поступает в картер

    Топливо в картере системы смазки

    Проблема с ненормальным повышением уровня масла в картере, когда смазка сильно пахнет топливом. В двухтактном двигателе топливо представляет собой смесь бензина и масла, но в четырехтактном двигателе внутреннего сгорания эти две жидкости нельзя смешивать.Циркуляция смазки в исправном двигателе происходит по замкнутому контуру: картер - блок цилиндров - топливный фильтр - масляный насос - головка блока цилиндров - блок цилиндров - картер. Сильный запах топлива, исходящий от щупа, который используется для измерения уровня масла, указывает на то, что бензин мог попасть в масло, и вам следует искать причины.

    Знаки утечки

    Водитель может узнать, что произошла утечка, по черной луже под автомобилем.Масло может вытечь из-под прокладки клапанной крышки, поврежденных сальников и прокладок картера. При попадании в окружающую среду масло, как правило, не смешивается с другими. моторные жидкости ... Смесь масла и бензина может образовываться только внутри двигателя и только при определенных обстоятельствах. Случаи попадания моторного масла в топливо также происходят вне автомобиля, например, на заправке или по неосторожности владельца запутавшейся канистры. Разделить эти вещества в гаражных условиях нереально, да и заливать такую ​​смесь в бак (кроме двухтактных) категорически не рекомендуется.Заметить присутствие в смазке значительного количества топлива можно по другим признакам: изменилась консистенция смазки, она стала более жидкой; смазка на масляном щупе вспыхивает при воспламенении спичкой; капля жира на бумаге оставляет вокруг себя жирный, расширяющийся ореол, который быстро испаряется. Если эти признаки присутствуют, то самое время посетить автосервис. Правило - хотя бы раз в неделю заглядывать под капот автомобиля и проверять уровень и состояние смазки, тормозной жидкости и антифриза станет хорошей привычкой для любого водителя, независимо от марки автомобиля.Своевременное обнаружение утечки сэкономит время и деньги.

    Причины утечки топлива в смазку

    Бензин, независимо от типа системы питания двигателя, после бензонасоса должен быть кратчайший путь к конечному пункту назначения - карбюратору (форсункам) и далее в камеру сгорания. Камера сгорания - это пространство между головкой блока цилиндров и головкой поршня, в котором происходит рабочее сгорание смеси бензин / воздух. Топливно-воздушная смесь, попадая в камеру сгорания, обходит впускные клапаны, горловины которых постоянно смазываются циркулирующим в системе маслом.Многие предполагают, что в этом месте есть утечка, и очень часто оказываются правы. Дело в том, что клапаны комплектуются резиновыми колпачками масляного дефлектора. Они сконструированы таким образом, что масло, смазывающее шейки клапанов, отражаясь от них, не попадает в камеру сгорания. Если из-за сильного износа колпачков туда попадет масло, то по запаху выхлопных газов машина будет напоминать мотоцикл, а дым из выхлопной трубы пойдет густым серым облаком. Вероятность того, что разбрызгивается во впускной коллектор и движется с большой скоростью. В камере сгорания топливовоздушная смесь поступает в систему смазки по одному и тому же пути - разница давлений будет втягивать смесь в цилиндры.Поэтому причины, по которым масло пахнет топливом, следует искать в другом месте. При запуске в холодную погоду первые несколько минут работы сжигают топливо не так эффективно, как на прогретом двигателе. Выхлоп часто пахнет неочищенным бензином, который не полностью воспламеняется в камере сгорания, из выхлопной трубы может капать конденсат. Это нормально и не имеет ничего общего с проблемами, описанными ниже.

    Бензонасос

    Конструкция системы подачи топлива у разных моделей машин может отличаться.В современных автомобилях с инжекторным двигателем бензин перекачивается с помощью электронасоса, в котором масло и топливо физически не могут встретиться, в отличие от карбюраторных автомобилей, оборудованных механическим бензонасосом. Мембранный механический насос нагнетает бензин в карбюратор. Шток насоса в некоторых марках автомобилей приводится в движение эксцентриком и получает масло из той же среды, что и распределительный вал. При поломке диафрагмы бензин может попасть в канал штока, и еще раз проверив уровень смазки щупом, водитель может заметить характерный запах масла.При незначительном повреждении мембраны топливного насоса уровень смазки может остаться прежним, при значительных разрывах мембраны бензин перестанет эффективно закачиваться в карбюратор, автомобиль будет плохо заводиться, и могут возникнуть проблемы при движении. Проблема устраняется заменой мембраны на новую из ремкомплекта бензонасоса. Конечно, не многие обращают внимание на запах смазки, но иногда он очень сильно пахнет бензином, что справедливо вызывает опасения.

    Форсунки

    В инжекторном двигателе запах топлива, исходящий от масляного щупа, может указывать на неисправность форсунок или системы зажигания. В первом случае речь идет о том, что одна или несколько форсунок закрываются неплотно и после остановки двигателя из-за остаточного давления топливо просачивается в коллектор, откуда затем поступает в цилиндры. Конечно, поршневые кольца - преграда на пути к картеру, но если степень их износа высока и есть заделка, то они не станут препятствием для потока топлива.Пахнет горючим, даже если неисправна система зажигания. При выходе из строя свечи в одном из цилиндров горючая смесь в ней не воспламеняется и не выполняет полезной работы. Топливно-воздушная смесь закачивается в цилиндр, где искры не возникает и часть топлива вылетает на выходе, а часть оседает на стенках цилиндра, снова перетекает в картер, отсюда и запах. Для устранения данной неисправности снимите топливную рампу и поочередно проверьте герметичность каждой форсунки, наполнив ее керосином или жидкостью для очистки форсунок от аэрозольного баллона под давлением.Негерметичные форсунки и поврежденные свечи зажигания заменяются исправными.

    Общие проблемы

    Итак, можно обобщить и выделить ту же проблему, которая возникает в карбюраторном и инжекторном типе двигателя - высокий уровень износа компрессионных и маслосъемных колец. Именно в этот момент топливо контактирует со смазкой. Топливо поступает в картер, смазка поднимается в камеру сгорания - этот замкнутый круг свидетельствует о необходимости капитального ремонта двигателя.Силовая установка значительно теряет мощность при уменьшении компрессии хотя бы в одном из цилиндров из-за утопленных в канавках компрессионных колец. Избыток топлива в камере сгорания дает переобогащенную смесь, что тоже нехорошо. Углеродный слой будет расти, и частый перегрев станет неизбежным. Разбавление смазки и, как следствие, изменение уровня ее вязкости опасно для двигателя внутреннего сгорания, работающего под нагрузкой на высоких оборотах.

    Последствия

    Бензин - довольно агрессивное химическое вещество.Современные лубрикаторы ICE содержат сложные системы присадок, которые не предназначены для прямого и длительного контакта с этилированным топливом, которые могут изменить физические и химические свойства смазочного материала. Если уровень масла на щупе поднялся выше отметки «Макс», а масло визуально меняет консистенцию и имеет характерный запах, то меры необходимо принимать немедленно. Антифриз можно принять за бензин, его уровень упал в расширительном бачке и то, как уровень эмульсии в картере двигателя ненормально поднялся, может означать, что это сломанная прокладка ГБЦ... Запрещается запускать двигатель с проколотой прокладкой во избежание гидроудара и заклинивания - автомобиль отбуксируется в сервисный центр с выключенным сцеплением. Небольшое количество бензина в смазке, конечно, не может навредить работе двигателя, и невозможно заметить, что уровень топлива падает, но водитель должен подумать, куда и как он уходит.

    .

    Автор: alexxlab

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *